Incidental Mutation 'R7820:E430018J23Rik'
ID601818
Institutional Source Beutler Lab
Gene Symbol E430018J23Rik
Ensembl Gene ENSMUSG00000078580
Gene NameRIKEN cDNA E430018J23 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127389673-127393629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127391436 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 460 (W460R)
Ref Sequence ENSEMBL: ENSMUSP00000126288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049052] [ENSMUST00000074249] [ENSMUST00000106303] [ENSMUST00000164345] [ENSMUST00000165495]
Predicted Effect probably benign
Transcript: ENSMUST00000049052
SMART Domains Protein: ENSMUSP00000038195
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 82 5.44e-25 SMART
low complexity region 102 115 N/A INTRINSIC
ZnF_C2H2 152 174 6.88e-4 SMART
ZnF_C2H2 180 202 1.47e-3 SMART
ZnF_C2H2 208 230 5.29e-5 SMART
ZnF_C2H2 236 258 4.87e-4 SMART
ZnF_C2H2 264 286 3.69e-4 SMART
ZnF_C2H2 292 314 1.47e-3 SMART
ZnF_C2H2 320 342 5.21e-4 SMART
ZnF_C2H2 348 370 1.45e-2 SMART
ZnF_C2H2 376 398 2.12e-4 SMART
ZnF_C2H2 404 427 1.45e-2 SMART
ZnF_C2H2 433 455 3.69e-4 SMART
ZnF_C2H2 461 483 6.67e-2 SMART
ZnF_C2H2 489 511 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074249
SMART Domains Protein: ENSMUSP00000073867
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 79 4.43e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106303
SMART Domains Protein: ENSMUSP00000101910
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 81 9.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164345
SMART Domains Protein: ENSMUSP00000131610
Gene: ENSMUSG00000030823

DomainStartEndE-ValueType
KRAB 22 67 1.65e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165495
AA Change: W460R

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580
AA Change: W460R

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in E430018J23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:E430018J23Rik APN 7 127392036 missense possibly damaging 0.92
IGL01782:E430018J23Rik APN 7 127393304 missense probably benign 0.02
IGL02174:E430018J23Rik APN 7 127392353 missense possibly damaging 0.54
IGL02882:E430018J23Rik APN 7 127392252 missense probably damaging 1.00
IGL03152:E430018J23Rik APN 7 127392297 missense probably damaging 1.00
R0552:E430018J23Rik UTSW 7 127392332 missense possibly damaging 0.92
R1828:E430018J23Rik UTSW 7 127391909 missense probably damaging 1.00
R1843:E430018J23Rik UTSW 7 127391488 missense probably benign 0.32
R1866:E430018J23Rik UTSW 7 127393331 missense probably damaging 1.00
R3429:E430018J23Rik UTSW 7 127391742 missense possibly damaging 0.79
R4433:E430018J23Rik UTSW 7 127393002 missense possibly damaging 0.75
R4933:E430018J23Rik UTSW 7 127393349 missense probably damaging 1.00
R5292:E430018J23Rik UTSW 7 127392487 missense possibly damaging 0.48
R6218:E430018J23Rik UTSW 7 127393409 missense possibly damaging 0.85
R6667:E430018J23Rik UTSW 7 127393423 missense probably benign 0.35
R6712:E430018J23Rik UTSW 7 127392310 missense probably damaging 1.00
R7108:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7214:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7215:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7216:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7313:E430018J23Rik UTSW 7 127391684 missense probably benign 0.23
R7396:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7397:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7398:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7478:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7479:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7480:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7481:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7512:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7652:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7716:E430018J23Rik UTSW 7 127392087 missense probably benign
R7999:E430018J23Rik UTSW 7 127392428 missense probably damaging 0.98
R8097:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8098:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8100:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8182:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8184:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8185:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R8309:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
X0022:E430018J23Rik UTSW 7 127393270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCATGGAGCTCTAGTGGG -3'
(R):5'- TTTCCCACGAAGTCAGCTG -3'

Sequencing Primer
(F):5'- GCCAGGACGACGGTACATC -3'
(R):5'- CAGCTGTGACAAAGCACCAGTG -3'
Posted On2019-12-03