Incidental Mutation 'R7820:Adam12'
ID601819
Institutional Source Beutler Lab
Gene Symbol Adam12
Ensembl Gene ENSMUSG00000054555
Gene Namea disintegrin and metallopeptidase domain 12 (meltrin alpha)
SynonymsMltna, ADAM12
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location133883199-134232146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133998188 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000123161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067680] [ENSMUST00000127524] [ENSMUST00000134504]
Predicted Effect probably benign
Transcript: ENSMUST00000067680
AA Change: V130A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065213
Gene: ENSMUSG00000054555
AA Change: V130A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 165 1.1e-27 PFAM
Pfam:Reprolysin_5 210 392 2.1e-24 PFAM
Pfam:Reprolysin_4 210 408 3.8e-16 PFAM
Pfam:Reprolysin 212 414 1.4e-74 PFAM
Pfam:Reprolysin_2 232 404 6e-18 PFAM
Pfam:Reprolysin_3 236 359 1.3e-16 PFAM
DISIN 431 506 4.29e-42 SMART
ACR 507 650 1.75e-67 SMART
transmembrane domain 705 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127524
AA Change: V99A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120094
Gene: ENSMUSG00000054555
AA Change: V99A

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 6 135 4.3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134504
AA Change: V99A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123161
Gene: ENSMUSG00000054555
AA Change: V99A

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 6 135 6.1e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein that localizes to the cell surface. About a third of the mice lacking the encoded protein die before weaning. Overexpression of the encoded protein in a mouse model of Duchenne muscular dystrophy alleviates the muscle pathology by preventing cell necrosis and inflammation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice display partial postnatal lethality, decreased brown fat, and impaired formation of neck and interscapular muscles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Adam12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Adam12 APN 7 133909881 missense possibly damaging 0.51
IGL01403:Adam12 APN 7 133919610 missense probably benign 0.00
IGL01482:Adam12 APN 7 133967848 missense probably damaging 1.00
IGL01922:Adam12 APN 7 133937472 nonsense probably null
IGL02397:Adam12 APN 7 133909819 splice site probably benign
IGL03401:Adam12 APN 7 133916463 missense probably damaging 1.00
R0122:Adam12 UTSW 7 134012348 missense probably benign 0.45
R0200:Adam12 UTSW 7 133974416 splice site probably null
R0463:Adam12 UTSW 7 133974416 splice site probably null
R0927:Adam12 UTSW 7 133998230 missense probably damaging 1.00
R1258:Adam12 UTSW 7 133937447 missense probably damaging 1.00
R1440:Adam12 UTSW 7 133931814 missense probably benign 0.03
R1483:Adam12 UTSW 7 133930025 missense probably benign 0.41
R1692:Adam12 UTSW 7 133887944 makesense probably null
R1797:Adam12 UTSW 7 133967861 missense probably benign 0.03
R2134:Adam12 UTSW 7 134012288 nonsense probably null
R2230:Adam12 UTSW 7 133919618 missense probably damaging 1.00
R2350:Adam12 UTSW 7 133919524 missense probably damaging 1.00
R2944:Adam12 UTSW 7 133975507 missense probably null 0.02
R3688:Adam12 UTSW 7 133964796 nonsense probably null
R3747:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R3749:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R3750:Adam12 UTSW 7 134172865 missense probably damaging 0.96
R4028:Adam12 UTSW 7 133929996 missense probably damaging 1.00
R4130:Adam12 UTSW 7 133912924 missense probably damaging 1.00
R4131:Adam12 UTSW 7 133912924 missense probably damaging 1.00
R4346:Adam12 UTSW 7 133981535 missense possibly damaging 0.82
R4701:Adam12 UTSW 7 133916462 missense possibly damaging 0.64
R4887:Adam12 UTSW 7 134172821 missense possibly damaging 0.74
R5355:Adam12 UTSW 7 133887942 makesense probably null
R5468:Adam12 UTSW 7 133975473 missense probably damaging 1.00
R5486:Adam12 UTSW 7 133907672 missense possibly damaging 0.75
R5990:Adam12 UTSW 7 133931736 missense probably damaging 1.00
R6504:Adam12 UTSW 7 133929984 missense probably damaging 1.00
R6783:Adam12 UTSW 7 133974397 missense probably damaging 1.00
R7117:Adam12 UTSW 7 133916462 missense probably benign 0.00
R7263:Adam12 UTSW 7 133919511 missense possibly damaging 0.68
R7749:Adam12 UTSW 7 134224813 missense unknown
R7880:Adam12 UTSW 7 133909962 missense possibly damaging 0.94
R7891:Adam12 UTSW 7 133998232 missense probably benign 0.00
R8114:Adam12 UTSW 7 133967888 missense probably damaging 1.00
X0057:Adam12 UTSW 7 134012315 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGCTGTGTAATTTGCAAGTAGC -3'
(R):5'- GTTGAATGGTAAGGCAGCCTG -3'

Sequencing Primer
(F):5'- TTGCAAGTAGCTATACAGGCCTC -3'
(R):5'- TAAGGCAGCCTGTGTCATAC -3'
Posted On2019-12-03