Incidental Mutation 'R7820:Mon1a'
ID601825
Institutional Source Beutler Lab
Gene Symbol Mon1a
Ensembl Gene ENSMUSG00000032583
Gene NameMON1 homolog A, secretory traffciking associated
Synonyms2810468K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107888151-107903139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107901312 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 245 (L245P)
Ref Sequence ENSEMBL: ENSMUSP00000141516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035202] [ENSMUST00000191906]
Predicted Effect probably damaging
Transcript: ENSMUST00000035202
AA Change: L245P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035202
Gene: ENSMUSG00000032583
AA Change: L245P

DomainStartEndE-ValueType
Pfam:Mon1 151 555 1.2e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191906
AA Change: L245P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141516
Gene: ENSMUSG00000032583
AA Change: L245P

DomainStartEndE-ValueType
Pfam:Mon1 146 461 1.1e-138 PFAM
Meta Mutation Damage Score 0.9073 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Mon1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mon1a APN 9 107902684 missense probably damaging 1.00
IGL02104:Mon1a APN 9 107901615 missense probably damaging 1.00
IGL02223:Mon1a APN 9 107901285 missense probably damaging 1.00
IGL02268:Mon1a APN 9 107901798 missense possibly damaging 0.95
R1334:Mon1a UTSW 9 107901363 missense probably damaging 0.99
R1708:Mon1a UTSW 9 107898718 missense probably benign 0.27
R1753:Mon1a UTSW 9 107901363 missense probably damaging 0.99
R3774:Mon1a UTSW 9 107901303 missense probably damaging 1.00
R4964:Mon1a UTSW 9 107902651 missense probably damaging 1.00
R4966:Mon1a UTSW 9 107902651 missense probably damaging 1.00
R5586:Mon1a UTSW 9 107898695 missense probably damaging 0.99
R5636:Mon1a UTSW 9 107901240 missense probably damaging 1.00
R6816:Mon1a UTSW 9 107900410 missense probably damaging 1.00
R7080:Mon1a UTSW 9 107901786 missense probably damaging 1.00
R7709:Mon1a UTSW 9 107900128 missense probably benign 0.05
R8263:Mon1a UTSW 9 107898794 missense probably benign
RF009:Mon1a UTSW 9 107901234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGTGAAGCTGTGTGCC -3'
(R):5'- TTGAAAAGCAGGTGCAGGTC -3'

Sequencing Primer
(F):5'- TGAAGCTGTGTGCCCACTG -3'
(R):5'- AATTGGTCCTTGCGGCGC -3'
Posted On2019-12-03