Mutagenetix > Incidental Mutation

Incidental Mutation 'R7820:Cacna1i'

601840

Institutional Source

Beutler Lab

Gene Symbol

Cacna1i

Ensembl Gene

ENSMUSG00000022416

Gene Name

calcium channel, voltage-dependent, alpha 1I subunit

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7820 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80287238-80398279 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80372372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 989 (A989V)

Ref Sequence

ENSEMBL: ENSMUSP00000125229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]

AlphaFold

E9Q7P2

Predicted Effect

probably benign
Transcript: ENSMUST00000160424
AA Change: A989V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: A989V

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	76	407	1.4e-79	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	597	830	7.4e-58	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1128	1401	7.8e-65	PFAM
Pfam:Ion_trans	1445	1700	9.4e-58	PFAM
Pfam:PKD_channel	1538	1694	1.4e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC
low complexity region	1837	1853	N/A	INTRINSIC
low complexity region	1922	1933	N/A	INTRINSIC
low complexity region	1990	2005	N/A	INTRINSIC
low complexity region	2041	2058	N/A	INTRINSIC
low complexity region	2087	2097	N/A	INTRINSIC
low complexity region	2103	2126	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162155
AA Change: A989V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: A989V

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	115	395	1.9e-66	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	632	819	2.4e-45	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1165	1389	6.2e-55	PFAM
coiled coil region	1394	1426	N/A	INTRINSIC
Pfam:Ion_trans	1480	1688	1.9e-47	PFAM
Pfam:PKD_channel	1538	1694	4.8e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933405O20Rik	T	A	7: 50,599,623	I135N	probably benign	Het
Abca14	A	T	7: 120,212,721	N175I	probably benign	Het
Adam12	A	G	7: 133,998,188	V99A	probably benign	Het
Ankfn1	G	T	11: 89,421,130	P730T	probably damaging	Het
Arhgap21	A	G	2: 20,863,172	S847P	probably damaging	Het
Cacnb2	T	A	2: 14,960,666	N152K	probably damaging	Het
Chd3	A	T	11: 69,353,238	Y1334N	probably damaging	Het
Clca4a	A	T	3: 144,960,671	D473E	probably damaging	Het
Crhr2	A	C	6: 55,102,779	I191S	probably damaging	Het
E430018J23Rik	A	T	7: 127,391,436	W460R	possibly damaging	Het
Eef1akmt3	T	C	10: 127,033,194	Q137R	possibly damaging	Het
Eml1	T	C	12: 108,515,174	I432T	possibly damaging	Het
Fcgbp	A	G	7: 28,120,359	T2504A	probably benign	Het
Hmgxb4	G	T	8: 75,000,946	E186*	probably null	Het
Ighv16-1	T	C	12: 114,068,969	N71S	probably benign	Het
Kif2b	A	G	11: 91,577,274	V61A	probably benign	Het
Map1b	C	T	13: 99,431,177	G1679R	unknown	Het
Mast4	G	A	13: 102,754,088	S1086L	probably damaging	Het
Mcm8	A	G	2: 132,840,772	E724G	possibly damaging	Het
Mfap5	C	A	6: 122,520,921	D51E	probably damaging	Het
Mon1a	T	C	9: 107,901,312	L245P	probably damaging	Het
Mtx1	G	T	3: 89,214,008	H106Q	probably benign	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Ngp	A	G	9: 110,420,864	T77A	probably benign	Het
Oca2	A	T	7: 56,331,965	I612F	probably damaging	Het
Odf3	A	C	7: 140,849,263	T128P	probably benign	Het
Olfr1224-ps1	T	A	2: 89,156,248	D309V	probably benign	Het
Olfr147	A	T	9: 38,403,566	I228F	probably damaging	Het
Olfr96	A	T	17: 37,225,895	M257L	probably benign	Het
Otop3	T	A	11: 115,339,588	V97D	probably damaging	Het
Ovgp1	A	G	3: 105,986,521		probably benign	Het
Pdc	T	C	1: 150,333,270	I168T	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Plekha7	A	T	7: 116,237,480	F18I	probably benign	Het
Plppr4	A	G	3: 117,321,949	I753T	possibly damaging	Het
Pms2	T	G	5: 143,914,633	S123A	possibly damaging	Het
Pou4f2	T	A	8: 78,436,502		probably benign	Het
Ptch1	A	T	13: 63,523,061	L885Q	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rgs11	T	A	17: 26,205,195		probably null	Het
Samd3	T	A	10: 26,233,518		probably null	Het
Slit3	A	G	11: 35,700,408	D1349G	probably benign	Het
Sorbs2	A	T	8: 45,796,556	Q868L	probably null	Het
Speer4f1	T	A	5: 17,479,530	S185R	probably damaging	Het
Spin2f	A	G	X: 31,254,699	K28R	probably benign	Het
Tas2r125	T	G	6: 132,909,878	I76M	probably benign	Het
Tex15	A	T	8: 33,575,062	I1507F	probably damaging	Het
Tmem2	C	T	19: 21,807,461	A436V	probably damaging	Het
Vmn1r215	A	T	13: 23,076,545	I252F	probably damaging	Het
Vmn1r71	A	G	7: 10,748,725	F12S	possibly damaging	Het
Zfp128	A	G	7: 12,891,022	Y439C	probably benign	Het

Other mutations in Cacna1i

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Cacna1i	APN	15	80382019	missense	probably damaging	1.00
IGL00976:Cacna1i	APN	15	80355645	missense	probably benign
IGL01338:Cacna1i	APN	15	80348380	missense	probably damaging	0.99
IGL01589:Cacna1i	APN	15	80387759	splice site	probably benign
IGL01669:Cacna1i	APN	15	80391757	missense	probably benign
IGL01807:Cacna1i	APN	15	80374147	missense	probably damaging	1.00
IGL01911:Cacna1i	APN	15	80391732	missense	probably benign	0.09
IGL01973:Cacna1i	APN	15	80382033	missense	probably damaging	1.00
IGL02205:Cacna1i	APN	15	80372951	missense	probably benign	0.06
IGL02519:Cacna1i	APN	15	80361874	nonsense	probably null
IGL02648:Cacna1i	APN	15	80298638	missense	probably damaging	0.96
IGL03033:Cacna1i	APN	15	80362239	missense	probably damaging	0.98
IGL03214:Cacna1i	APN	15	80355716	missense	probably benign	0.30
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0295:Cacna1i	UTSW	15	80356211	missense	probably damaging	1.00
R0345:Cacna1i	UTSW	15	80372462	missense	probably damaging	0.98
R0415:Cacna1i	UTSW	15	80368830	splice site	probably benign
R0637:Cacna1i	UTSW	15	80372654	missense	probably damaging	0.99
R0638:Cacna1i	UTSW	15	80381080	missense	possibly damaging	0.94
R0840:Cacna1i	UTSW	15	80358949	missense	possibly damaging	0.85
R1463:Cacna1i	UTSW	15	80379054	missense	possibly damaging	0.96
R1528:Cacna1i	UTSW	15	80391774	splice site	probably null
R1563:Cacna1i	UTSW	15	80321188	missense	probably damaging	0.97
R1563:Cacna1i	UTSW	15	80389855	splice site	probably benign
R1573:Cacna1i	UTSW	15	80393668	splice site	probably null
R1654:Cacna1i	UTSW	15	80389210	missense	probably damaging	1.00
R1754:Cacna1i	UTSW	15	80371529	missense	probably damaging	0.99
R1794:Cacna1i	UTSW	15	80389122	missense	probably damaging	1.00
R1824:Cacna1i	UTSW	15	80376789	missense	possibly damaging	0.64
R1863:Cacna1i	UTSW	15	80358931	missense	probably damaging	1.00
R1885:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1886:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1899:Cacna1i	UTSW	15	80391642	missense	possibly damaging	0.91
R1907:Cacna1i	UTSW	15	80375264	missense	probably damaging	1.00
R1943:Cacna1i	UTSW	15	80395044	missense	probably benign
R2162:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R2888:Cacna1i	UTSW	15	80374767	missense	probably damaging	1.00
R3701:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3702:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3832:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R4852:Cacna1i	UTSW	15	80388479	missense	probably damaging	0.99
R4857:Cacna1i	UTSW	15	80369662	missense	probably damaging	1.00
R4950:Cacna1i	UTSW	15	80368671	missense	probably damaging	1.00
R4980:Cacna1i	UTSW	15	80348449	missense	probably damaging	0.97
R5217:Cacna1i	UTSW	15	80390840	missense	possibly damaging	0.94
R5437:Cacna1i	UTSW	15	80371529	missense	probably damaging	1.00
R5519:Cacna1i	UTSW	15	80371499	missense	probably damaging	1.00
R5642:Cacna1i	UTSW	15	80395078	missense	possibly damaging	0.47
R6217:Cacna1i	UTSW	15	80389132	missense	probably damaging	1.00
R6225:Cacna1i	UTSW	15	80321226	missense	probably damaging	1.00
R6251:Cacna1i	UTSW	15	80336682	missense	probably damaging	1.00
R6463:Cacna1i	UTSW	15	80355758	missense	probably damaging	0.97
R6490:Cacna1i	UTSW	15	80378247	missense	probably damaging	1.00
R6613:Cacna1i	UTSW	15	80321259	missense	probably damaging	1.00
R6884:Cacna1i	UTSW	15	80374809	missense	probably damaging	1.00
R6904:Cacna1i	UTSW	15	80374801	missense	probably damaging	1.00
R7017:Cacna1i	UTSW	15	80380470	missense	probably damaging	1.00
R7155:Cacna1i	UTSW	15	80395238	missense	probably benign	0.04
R7274:Cacna1i	UTSW	15	80376822	missense	possibly damaging	0.95
R7323:Cacna1i	UTSW	15	80391653	missense	possibly damaging	0.86
R7335:Cacna1i	UTSW	15	80375575	missense	probably damaging	1.00
R7571:Cacna1i	UTSW	15	80375336	missense	probably damaging	1.00
R7768:Cacna1i	UTSW	15	80381188	missense	probably damaging	1.00
R7987:Cacna1i	UTSW	15	80320352	splice site	probably null
R8150:Cacna1i	UTSW	15	80375339	missense	probably damaging	1.00
R8206:Cacna1i	UTSW	15	80389815	splice site	probably null
R8270:Cacna1i	UTSW	15	80373634	missense	probably damaging	0.99
R8382:Cacna1i	UTSW	15	80376816	missense	probably damaging	0.99
R8501:Cacna1i	UTSW	15	80382046	critical splice donor site	probably null
R8518:Cacna1i	UTSW	15	80358894	nonsense	probably null
R8552:Cacna1i	UTSW	15	80320397	missense	possibly damaging	0.69
R8679:Cacna1i	UTSW	15	80375810	intron	probably benign
R8696:Cacna1i	UTSW	15	80381974	missense	probably damaging	0.98
R8887:Cacna1i	UTSW	15	80374693	missense	possibly damaging	0.91
R9274:Cacna1i	UTSW	15	80370153	missense	probably damaging	1.00
R9379:Cacna1i	UTSW	15	80375294	missense	probably damaging	1.00
R9508:Cacna1i	UTSW	15	80395171	missense	probably benign	0.06
R9518:Cacna1i	UTSW	15	80387777	missense	probably damaging	1.00
R9674:Cacna1i	UTSW	15	80380428	missense	probably damaging	1.00
R9747:Cacna1i	UTSW	15	80362117	missense	probably benign	0.11
R9769:Cacna1i	UTSW	15	80369592	missense	probably damaging	1.00
X0022:Cacna1i	UTSW	15	80361962	missense	probably damaging	0.99
X0024:Cacna1i	UTSW	15	80362139	missense	probably benign	0.03
X0058:Cacna1i	UTSW	15	80379102	missense	probably damaging	1.00
Z1177:Cacna1i	UTSW	15	80381179	missense	possibly damaging	0.64
Z1177:Cacna1i	UTSW	15	80389383	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- ATCCAAGTCCGGGTCTTTCC -3'
(R):5'- ACATCCTTGGCTATGTTGGGC -3'

Sequencing Primer
(F):5'- TCCCGGAGCTCCTACTATGG -3'
(R):5'- ATTGCAGTCCTCGTGCCCAG -3'

Posted On

2019-12-03