Incidental Mutation 'R7820:Olfr96'
ID601841
Institutional Source Beutler Lab
Gene Symbol Olfr96
Ensembl Gene ENSMUSG00000064121
Gene Nameolfactory receptor 96
SynonymsGA_x6K02T2PSCP-1665046-1665987, MOR121-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37220146-37226673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37225895 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 257 (M257L)
Ref Sequence ENSEMBL: ENSMUSP00000151151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078209] [ENSMUST00000213475] [ENSMUST00000214482]
Predicted Effect probably benign
Transcript: ENSMUST00000078209
AA Change: M257L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000077338
Gene: ENSMUSG00000064121
AA Change: M257L

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.6e-53 PFAM
Pfam:7tm_1 43 291 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213475
AA Change: M257L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000214482
AA Change: M257L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Olfr96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Olfr96 APN 17 37225152 missense probably benign 0.05
IGL02151:Olfr96 APN 17 37225166 missense probably damaging 1.00
IGL02335:Olfr96 APN 17 37225326 missense probably damaging 0.97
R0360:Olfr96 UTSW 17 37226043 missense possibly damaging 0.49
R0364:Olfr96 UTSW 17 37226043 missense possibly damaging 0.49
R1763:Olfr96 UTSW 17 37225430 missense probably benign 0.02
R3977:Olfr96 UTSW 17 37225158 missense probably benign 0.24
R6116:Olfr96 UTSW 17 37225568 missense probably benign 0.00
R6248:Olfr96 UTSW 17 37225560 nonsense probably null
R6378:Olfr96 UTSW 17 37225797 missense probably benign 0.21
R6518:Olfr96 UTSW 17 37225268 missense probably benign 0.05
R6614:Olfr96 UTSW 17 37225899 missense probably benign 0.01
R6798:Olfr96 UTSW 17 37225806 missense probably damaging 1.00
R6874:Olfr96 UTSW 17 37225347 missense probably benign 0.00
R7468:Olfr96 UTSW 17 37225385 missense probably benign 0.01
R7852:Olfr96 UTSW 17 37225272 missense probably benign 0.01
R7935:Olfr96 UTSW 17 37225272 missense probably benign 0.01
X0027:Olfr96 UTSW 17 37225743 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCACCTTTGATGGTCCTGGC -3'
(R):5'- TAGAAAATCTTCACTGCCCTCC -3'

Sequencing Primer
(F):5'- TTGCTCAGATACCCAAGTGG -3'
(R):5'- CTTCTTAGGTCACATTTCAGTTGG -3'
Posted On2019-12-03