Mutagenetix > Incidental Mutation

Incidental Mutation 'R7821:Galnt2'

601874

Institutional Source

Beutler Lab

Gene Symbol

Galnt2

Ensembl Gene

ENSMUSG00000089704

Gene Name

polypeptide N-acetylgalactosaminyltransferase 2

Synonyms

ppGaNTase-T2

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R7821 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124231391-124345724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 124343395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 550 (S550R)

Ref Sequence

ENSEMBL: ENSMUSP00000034458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]

AlphaFold

Q6PB93

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034458
AA Change: S550R

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: S550R

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	25	39	N/A	INTRINSIC
Pfam:Glycos_transf_2	138	321	8.3e-31	PFAM
Pfam:Glyco_transf_7C	295	365	5.4e-8	PFAM
RICIN	440	565	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127664
AA Change: S516R

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: S516R

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Allele List at MGI

None

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	A	G	14: 95,882,050	Q81R	possibly damaging	Het
5830473C10Rik	T	C	5: 90,592,888	V560A	possibly damaging	Het
Aass	T	A	6: 23,120,930	T112S	probably damaging	Het
Abca12	G	T	1: 71,259,791	S2320R	probably benign	Het
Abca7	TGGTGCGTGAG	TG	10: 80,002,590		probably benign	Het
Adh7	T	A	3: 138,226,375	I250N	probably damaging	Het
Aoc1	T	A	6: 48,905,811	I229N	probably damaging	Het
C2cd6	A	T	1: 59,067,792	Y291*	probably null	Het
Cacnb4	T	C	2: 52,434,508	D514G	possibly damaging	Het
Clec2g	A	G	6: 128,948,777	T50A	probably benign	Het
Col6a5	T	C	9: 105,864,259	E2487G	probably damaging	Het
D130040H23Rik	A	T	8: 69,300,235		probably null	Het
D6Ertd527e	G	A	6: 87,110,897	S14N	unknown	Het
Dchs1	G	A	7: 105,765,145	T821I	probably benign	Het
Dhcr24	T	C	4: 106,571,436	S138P	possibly damaging	Het
Dhrs9	G	A	2: 69,394,438	G157R	probably damaging	Het
Dnah5	T	A	15: 28,411,532	D3682E	possibly damaging	Het
Dst	T	C	1: 34,275,362		probably null	Het
Fat1	A	T	8: 44,950,224	H4L	probably benign	Het
Flnb	A	G	14: 7,939,113	I2319V	probably benign	Het
Foxe1	T	C	4: 46,344,578	W129R	probably damaging	Het
Foxred2	G	A	15: 77,943,350	P603L	probably benign	Het
Fshr	A	G	17: 88,986,213	S346P	probably damaging	Het
Gpc2	A	G	5: 138,276,297	S312P	probably benign	Het
Gpr150	C	A	13: 76,056,392	A145S	probably benign	Het
Grk4	T	A	5: 34,710,209	W173R	probably damaging	Het
Hoxb9	C	G	11: 96,271,711	P57R	probably damaging	Het
Hsf5	A	G	11: 87,638,128	Q563R	probably benign	Het
Ighv1-58	A	G	12: 115,312,176	F114S	possibly damaging	Het
Klra9	T	A	6: 130,185,600	I158F	probably damaging	Het
Lrrc8d	T	C	5: 105,812,344	S207P	probably damaging	Het
Nbeal2	T	C	9: 110,630,252	E1929G	probably damaging	Het
Ncoa1	A	G	12: 4,296,221	M89T	probably benign	Het
Nkx2-4	T	C	2: 147,085,288	I20V	probably benign	Het
Nup214	T	C	2: 32,026,905	S1191P	possibly damaging	Het
Olfr136	A	G	17: 38,335,964	D269G	probably benign	Het
Pfkp	T	A	13: 6,597,872	N556I	probably damaging	Het
Pidd1	A	T	7: 141,442,280	S199T	probably benign	Het
Pik3r2	T	A	8: 70,769,764	I515F	probably damaging	Het
Plcxd2	T	A	16: 45,965,161	I294F	probably damaging	Het
Prmt6	C	A	3: 110,250,987		probably benign	Het
Prpf8	A	G	11: 75,494,474	I812V	probably benign	Het
Rasa2	T	C	9: 96,580,484		probably null	Het
Rsad1	A	C	11: 94,544,462	D266E	probably benign	Het
Rsf1	GGCG	GGCGACGGCTGCG	7: 97,579,906		probably benign	Het
Shroom3	T	A	5: 92,940,846	V485E	probably damaging	Het
Siae	T	A	9: 37,644,900	Y451N	probably damaging	Het
Slc7a11	A	T	3: 50,381,027	I354N	probably damaging	Het
Spryd7	A	T	14: 61,545,680		probably null	Het
Srcap	A	G	7: 127,530,327		probably benign	Het
Svep1	T	A	4: 58,179,601	D214V	probably damaging	Het
Tmtc4	T	C	14: 122,971,877	I119V	probably benign	Het
Trim5	G	A	7: 104,278,426	T169I	probably benign	Het
Ttc33	T	C	15: 5,212,025	F83S	probably benign	Het
Ubr5	A	T	15: 37,997,187	S1741T	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdcp	A	G	12: 4,857,975	N694S	probably benign	Het
Zfp174	T	A	16: 3,848,177	I102N	probably damaging	Het
Zfp354a	T	C	11: 51,069,712	F248S	probably damaging	Het
Zfyve26	A	T	12: 79,255,324	C404S	probably damaging	Het
Zmynd8	A	T	2: 165,881,080		probably benign	Het

Other mutations in Galnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02187:Galnt2	APN	8	124305506	splice site	probably benign
IGL02638:Galnt2	APN	8	124231579	missense	probably damaging	0.98
chivalry	UTSW	8	124334286	nonsense	probably null
feudal	UTSW	8	124332098	critical splice donor site	probably null
gallantry	UTSW	8	124340822	missense	probably damaging	1.00
valor	UTSW	8	124329788	missense	probably damaging	1.00
P0018:Galnt2	UTSW	8	124336611	missense	probably damaging	1.00
R0133:Galnt2	UTSW	8	124338538	missense	probably benign	0.19
R0453:Galnt2	UTSW	8	124338584	splice site	probably benign
R0709:Galnt2	UTSW	8	124343346	missense	probably benign	0.01
R1015:Galnt2	UTSW	8	124336617	missense	probably benign
R4388:Galnt2	UTSW	8	124295453	critical splice donor site	probably null
R4400:Galnt2	UTSW	8	124324303	missense	probably damaging	1.00
R4447:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4448:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4449:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4450:Galnt2	UTSW	8	124295377	missense	probably benign	0.04
R4927:Galnt2	UTSW	8	124305623	missense	probably damaging	1.00
R5536:Galnt2	UTSW	8	124323673	missense	probably damaging	1.00
R6218:Galnt2	UTSW	8	124343315	missense	probably benign	0.01
R6732:Galnt2	UTSW	8	124340822	missense	probably damaging	1.00
R6795:Galnt2	UTSW	8	124343436	missense	probably damaging	1.00
R6823:Galnt2	UTSW	8	124324011	missense	probably benign
R7173:Galnt2	UTSW	8	124305553	missense	probably benign	0.00
R7479:Galnt2	UTSW	8	124334338	missense	probably damaging	1.00
R7818:Galnt2	UTSW	8	124329788	missense	probably damaging	1.00
R7831:Galnt2	UTSW	8	124332078	missense	probably benign	0.04
R8348:Galnt2	UTSW	8	124334286	nonsense	probably null
R8770:Galnt2	UTSW	8	124334286	nonsense	probably null
R8826:Galnt2	UTSW	8	124305608	missense	probably damaging	1.00
R9054:Galnt2	UTSW	8	124332098	critical splice donor site	probably null
R9269:Galnt2	UTSW	8	124338463	missense	probably benign	0.02
X0024:Galnt2	UTSW	8	124343345	missense	probably benign	0.28
Z1177:Galnt2	UTSW	8	124343318	missense	probably benign	0.24

Predicted Primers

PCR Primer
(F):5'- GCTTAGCCGTTAAAGACTAGGC -3'
(R):5'- ACTGTCAGACCGTGATGGAAC -3'

Sequencing Primer
(F):5'- GCCGTTAAAGACTAGGCTCACAATC -3'
(R):5'- AACACTGAGGTATATAGTTTTGCGG -3'

Posted On

2019-12-03