Incidental Mutation 'R7821:Siae'
ID601875
Institutional Source Beutler Lab
Gene Symbol Siae
Ensembl Gene ENSMUSG00000001942
Gene Namesialic acid acetylesterase
SynonymsLSE, clone 165, Ysg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7821 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location37555698-37649655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37644900 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 451 (Y451N)
Ref Sequence ENSEMBL: ENSMUSP00000149505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000117654] [ENSMUST00000142736] [ENSMUST00000213126] [ENSMUST00000215474]
Predicted Effect probably damaging
Transcript: ENSMUST00000002007
AA Change: Y379N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942
AA Change: Y379N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:DUF303 118 420 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117654
SMART Domains Protein: ENSMUSP00000112600
Gene: ENSMUSG00000011114

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
coiled coil region 56 79 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 124 156 N/A INTRINSIC
FYRN 192 235 1.05e-18 SMART
Pfam:FYRC 238 316 1.4e-23 PFAM
low complexity region 349 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142736
Predicted Effect probably damaging
Transcript: ENSMUST00000213126
AA Change: Y416N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000215474
AA Change: Y451N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,050 Q81R possibly damaging Het
5830473C10Rik T C 5: 90,592,888 V560A possibly damaging Het
Aass T A 6: 23,120,930 T112S probably damaging Het
Abca12 G T 1: 71,259,791 S2320R probably benign Het
Abca7 TGGTGCGTGAG TG 10: 80,002,590 probably benign Het
Adh7 T A 3: 138,226,375 I250N probably damaging Het
Aoc1 T A 6: 48,905,811 I229N probably damaging Het
C2cd6 A T 1: 59,067,792 Y291* probably null Het
Cacnb4 T C 2: 52,434,508 D514G possibly damaging Het
Clec2g A G 6: 128,948,777 T50A probably benign Het
Col6a5 T C 9: 105,864,259 E2487G probably damaging Het
D130040H23Rik A T 8: 69,300,235 probably null Het
D6Ertd527e G A 6: 87,110,897 S14N unknown Het
Dchs1 G A 7: 105,765,145 T821I probably benign Het
Dhcr24 T C 4: 106,571,436 S138P possibly damaging Het
Dhrs9 G A 2: 69,394,438 G157R probably damaging Het
Dnah5 T A 15: 28,411,532 D3682E possibly damaging Het
Dst T C 1: 34,275,362 probably null Het
Fat1 A T 8: 44,950,224 H4L probably benign Het
Flnb A G 14: 7,939,113 I2319V probably benign Het
Foxe1 T C 4: 46,344,578 W129R probably damaging Het
Foxred2 G A 15: 77,943,350 P603L probably benign Het
Fshr A G 17: 88,986,213 S346P probably damaging Het
Galnt2 T A 8: 124,343,395 S550R possibly damaging Het
Gpc2 A G 5: 138,276,297 S312P probably benign Het
Gpr150 C A 13: 76,056,392 A145S probably benign Het
Grk4 T A 5: 34,710,209 W173R probably damaging Het
Hoxb9 C G 11: 96,271,711 P57R probably damaging Het
Hsf5 A G 11: 87,638,128 Q563R probably benign Het
Ighv1-58 A G 12: 115,312,176 F114S possibly damaging Het
Klra9 T A 6: 130,185,600 I158F probably damaging Het
Lrrc8d T C 5: 105,812,344 S207P probably damaging Het
Nbeal2 T C 9: 110,630,252 E1929G probably damaging Het
Ncoa1 A G 12: 4,296,221 M89T probably benign Het
Nkx2-4 T C 2: 147,085,288 I20V probably benign Het
Nup214 T C 2: 32,026,905 S1191P possibly damaging Het
Olfr136 A G 17: 38,335,964 D269G probably benign Het
Pfkp T A 13: 6,597,872 N556I probably damaging Het
Pidd1 A T 7: 141,442,280 S199T probably benign Het
Pik3r2 T A 8: 70,769,764 I515F probably damaging Het
Plcxd2 T A 16: 45,965,161 I294F probably damaging Het
Prmt6 C A 3: 110,250,987 probably benign Het
Prpf8 A G 11: 75,494,474 I812V probably benign Het
Rasa2 T C 9: 96,580,484 probably null Het
Rsad1 A C 11: 94,544,462 D266E probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Shroom3 T A 5: 92,940,846 V485E probably damaging Het
Slc7a11 A T 3: 50,381,027 I354N probably damaging Het
Spryd7 A T 14: 61,545,680 probably null Het
Srcap A G 7: 127,530,327 probably benign Het
Svep1 T A 4: 58,179,601 D214V probably damaging Het
Tmtc4 T C 14: 122,971,877 I119V probably benign Het
Trim5 G A 7: 104,278,426 T169I probably benign Het
Ttc33 T C 15: 5,212,025 F83S probably benign Het
Ubr5 A T 15: 37,997,187 S1741T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdcp A G 12: 4,857,975 N694S probably benign Het
Zfp174 T A 16: 3,848,177 I102N probably damaging Het
Zfp354a T C 11: 51,069,712 F248S probably damaging Het
Zfyve26 A T 12: 79,255,324 C404S probably damaging Het
Zmynd8 A T 2: 165,881,080 probably benign Het
Other mutations in Siae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Siae APN 9 37631486 missense probably damaging 0.98
IGL02696:Siae APN 9 37631384 missense probably damaging 1.00
BB009:Siae UTSW 9 37633684 missense probably benign 0.12
BB019:Siae UTSW 9 37633684 missense probably benign 0.12
R0531:Siae UTSW 9 37627794 missense probably benign 0.04
R1138:Siae UTSW 9 37642692 missense probably damaging 1.00
R1748:Siae UTSW 9 37631606 critical splice donor site probably null
R2175:Siae UTSW 9 37627796 missense probably damaging 1.00
R4301:Siae UTSW 9 37633713 missense possibly damaging 0.51
R4887:Siae UTSW 9 37627800 missense possibly damaging 0.93
R4989:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5133:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5134:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5151:Siae UTSW 9 37631573 missense probably benign 0.02
R5242:Siae UTSW 9 37644852 missense probably damaging 1.00
R5459:Siae UTSW 9 37616823 missense probably damaging 1.00
R5571:Siae UTSW 9 37616923 missense probably benign 0.01
R6335:Siae UTSW 9 37632981 missense probably benign 0.03
R6552:Siae UTSW 9 37646400 missense possibly damaging 0.57
R6692:Siae UTSW 9 37642799 critical splice donor site probably null
R6694:Siae UTSW 9 37616823 missense probably damaging 1.00
R7183:Siae UTSW 9 37616946 missense possibly damaging 0.77
R7266:Siae UTSW 9 37623013 missense probably damaging 0.98
R7697:Siae UTSW 9 37633654 missense probably damaging 1.00
R7932:Siae UTSW 9 37633684 missense probably benign 0.12
R8312:Siae UTSW 9 37646297 missense
R8377:Siae UTSW 9 37631605 critical splice donor site probably null
R8868:Siae UTSW 9 37616836 missense probably damaging 1.00
Z1176:Siae UTSW 9 37631469 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGGTTGCTAGCTCAAAGAC -3'
(R):5'- TGCACTATCAAACTGGTGTGC -3'

Sequencing Primer
(F):5'- GTGGTTGCTAGCTCAAAGACACTATC -3'
(R):5'- ACTGGTGTGCAAACAAATGATC -3'
Posted On2019-12-03