Incidental Mutation 'R7821:Nbeal2'
ID601877
Institutional Source Beutler Lab
Gene Symbol Nbeal2
Ensembl Gene ENSMUSG00000056724
Gene Nameneurobeachin-like 2
Synonyms1110014F23Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R7821 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location110624789-110654161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110630252 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1929 (E1929G)
Ref Sequence ENSEMBL: ENSMUSP00000121373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133191] [ENSMUST00000167320] [ENSMUST00000196488]
Predicted Effect probably benign
Transcript: ENSMUST00000123996
Predicted Effect
SMART Domains Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: E1217G

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 236 248 N/A INTRINSIC
Pfam:DUF4704 345 607 2.5e-29 PFAM
low complexity region 649 664 N/A INTRINSIC
low complexity region 804 819 N/A INTRINSIC
Pfam:DUF4800 872 1138 9.9e-113 PFAM
low complexity region 1164 1193 N/A INTRINSIC
Pfam:PH_BEACH 1204 1291 2.2e-21 PFAM
Beach 1343 1623 5.2e-205 SMART
WD40 1721 1766 1.03e1 SMART
WD40 1769 1808 6.19e-5 SMART
WD40 1820 1859 1.02e-5 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724
AA Change: E288G

DomainStartEndE-ValueType
Pfam:DUF4800 1 209 7.5e-97 PFAM
low complexity region 235 264 N/A INTRINSIC
Pfam:PH_BEACH 275 362 1e-21 PFAM
Beach 414 694 5.2e-205 SMART
WD40 762 807 1.03e1 SMART
WD40 810 849 6.19e-5 SMART
WD40 861 900 1.02e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133191
AA Change: E1929G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: E1929G

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
Pfam:Laminin_G_3 578 818 5.9e-8 PFAM
low complexity region 1014 1028 N/A INTRINSIC
low complexity region 1128 1136 N/A INTRINSIC
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1359 1375 N/A INTRINSIC
low complexity region 1515 1530 N/A INTRINSIC
low complexity region 1621 1647 N/A INTRINSIC
low complexity region 1875 1904 N/A INTRINSIC
Pfam:PH_BEACH 1908 2002 6.2e-28 PFAM
Beach 2054 2334 5.2e-205 SMART
WD40 2432 2477 1.03e1 SMART
WD40 2480 2519 6.19e-5 SMART
WD40 2531 2570 1.02e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167320
AA Change: E1936G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: E1936G

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 763 775 N/A INTRINSIC
Pfam:DUF4704 872 1148 9.2e-32 PFAM
low complexity region 1149 1163 N/A INTRINSIC
low complexity region 1366 1382 N/A INTRINSIC
low complexity region 1522 1537 N/A INTRINSIC
Pfam:DUF4800 1590 1856 1.5e-112 PFAM
low complexity region 1882 1911 N/A INTRINSIC
Pfam:PH_BEACH 1922 2009 3.1e-21 PFAM
Beach 2061 2341 5.2e-205 SMART
WD40 2439 2484 1.03e1 SMART
WD40 2487 2526 6.19e-5 SMART
WD40 2538 2577 1.02e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196488
AA Change: E1902G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: E1902G

DomainStartEndE-ValueType
low complexity region 56 84 N/A INTRINSIC
low complexity region 192 201 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 487 495 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
Pfam:Laminin_G_3 551 791 5.3e-6 PFAM
low complexity region 987 1001 N/A INTRINSIC
low complexity region 1101 1109 N/A INTRINSIC
low complexity region 1122 1136 N/A INTRINSIC
low complexity region 1332 1348 N/A INTRINSIC
low complexity region 1488 1503 N/A INTRINSIC
low complexity region 1594 1620 N/A INTRINSIC
low complexity region 1848 1877 N/A INTRINSIC
Pfam:PH_BEACH 1881 1975 3.1e-25 PFAM
Beach 2027 2307 3.8e-209 SMART
WD40 2405 2450 6.3e-2 SMART
WD40 2453 2492 3.8e-7 SMART
WD40 2504 2543 6.5e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,050 Q81R possibly damaging Het
5830473C10Rik T C 5: 90,592,888 V560A possibly damaging Het
Aass T A 6: 23,120,930 T112S probably damaging Het
Abca12 G T 1: 71,259,791 S2320R probably benign Het
Abca7 TGGTGCGTGAG TG 10: 80,002,590 probably benign Het
Adh7 T A 3: 138,226,375 I250N probably damaging Het
Aoc1 T A 6: 48,905,811 I229N probably damaging Het
C2cd6 A T 1: 59,067,792 Y291* probably null Het
Cacnb4 T C 2: 52,434,508 D514G possibly damaging Het
Clec2g A G 6: 128,948,777 T50A probably benign Het
Col6a5 T C 9: 105,864,259 E2487G probably damaging Het
D6Ertd527e G A 6: 87,110,897 S14N unknown Het
Dchs1 G A 7: 105,765,145 T821I probably benign Het
Dhcr24 T C 4: 106,571,436 S138P possibly damaging Het
Dhrs9 G A 2: 69,394,438 G157R probably damaging Het
Dnah5 T A 15: 28,411,532 D3682E possibly damaging Het
Dst T C 1: 34,275,362 probably null Het
Fat1 A T 8: 44,950,224 H4L probably benign Het
Flnb A G 14: 7,939,113 I2319V probably benign Het
Foxe1 T C 4: 46,344,578 W129R probably damaging Het
Fshr A G 17: 88,986,213 S346P probably damaging Het
Galnt2 T A 8: 124,343,395 S550R possibly damaging Het
Gpc2 A G 5: 138,276,297 S312P probably benign Het
Gpr150 C A 13: 76,056,392 A145S probably benign Het
Grk4 T A 5: 34,710,209 W173R probably damaging Het
Hsf5 A G 11: 87,638,128 Q563R probably benign Het
Ighv1-58 A G 12: 115,312,176 F114S possibly damaging Het
Klra9 T A 6: 130,185,600 I158F probably damaging Het
Lrrc8d T C 5: 105,812,344 S207P probably damaging Het
Ncoa1 A G 12: 4,296,221 M89T probably benign Het
Nkx2-4 T C 2: 147,085,288 I20V probably benign Het
Nup214 T C 2: 32,026,905 S1191P possibly damaging Het
Olfr136 A G 17: 38,335,964 D269G probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pfkp T A 13: 6,597,872 N556I probably damaging Het
Pidd1 A T 7: 141,442,280 S199T probably benign Het
Pik3r2 T A 8: 70,769,764 I515F probably damaging Het
Plcxd2 T A 16: 45,965,161 I294F probably damaging Het
Prmt6 C A 3: 110,250,987 probably benign Het
Prpf8 A G 11: 75,494,474 I812V probably benign Het
Rsad1 A C 11: 94,544,462 D266E probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Shroom3 T A 5: 92,940,846 V485E probably damaging Het
Siae T A 9: 37,644,900 Y451N probably damaging Het
Slc7a11 A T 3: 50,381,027 I354N probably damaging Het
Spryd7 A T 14: 61,545,680 probably null Het
Srcap A G 7: 127,530,327 probably benign Het
Svep1 T A 4: 58,179,601 D214V probably damaging Het
Tmtc4 T C 14: 122,971,877 I119V probably benign Het
Trim5 G A 7: 104,278,426 T169I probably benign Het
Ttc33 T C 15: 5,212,025 F83S probably benign Het
Ubr5 A T 15: 37,997,187 S1741T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdcp A G 12: 4,857,975 N694S probably benign Het
Zfp174 T A 16: 3,848,177 I102N probably damaging Het
Zfp354a T C 11: 51,069,712 F248S probably damaging Het
Zfyve26 A T 12: 79,255,324 C404S probably damaging Het
Other mutations in Nbeal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Nbeal2 APN 9 110635869 missense probably damaging 1.00
IGL00784:Nbeal2 APN 9 110629763 splice site probably benign
IGL00826:Nbeal2 APN 9 110626903 missense probably benign
IGL00885:Nbeal2 APN 9 110638661 missense probably damaging 1.00
IGL01348:Nbeal2 APN 9 110629146 missense probably damaging 0.99
IGL01511:Nbeal2 APN 9 110629234 missense probably damaging 1.00
IGL01571:Nbeal2 APN 9 110632758 missense possibly damaging 0.63
IGL01612:Nbeal2 APN 9 110644678 missense probably damaging 1.00
IGL01924:Nbeal2 APN 9 110631414 missense probably benign 0.23
IGL02056:Nbeal2 APN 9 110627324 missense probably benign 0.17
IGL02481:Nbeal2 APN 9 110625995 nonsense probably null
IGL02483:Nbeal2 APN 9 110625995 nonsense probably null
IGL02502:Nbeal2 APN 9 110633768 missense probably damaging 1.00
IGL02631:Nbeal2 APN 9 110630208 missense probably damaging 0.99
IGL02637:Nbeal2 APN 9 110625977 missense possibly damaging 0.62
IGL02727:Nbeal2 APN 9 110639285 splice site probably benign
IGL02887:Nbeal2 APN 9 110628276 missense probably damaging 1.00
IGL02896:Nbeal2 APN 9 110639292 critical splice donor site probably null
IGL03110:Nbeal2 APN 9 110631433 missense probably damaging 1.00
legion UTSW 9 110629179 missense probably damaging 1.00
litigious UTSW 9 110628195 missense probably damaging 1.00
mall UTSW 9 110632886 missense probably damaging 1.00
Mollusca UTSW 9 110645438 intron probably null
schleuter UTSW 9 110628744 missense possibly damaging 0.69
shellfish UTSW 9 110628720 missense probably damaging 1.00
F5770:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
R0032:Nbeal2 UTSW 9 110637868 splice site probably benign
R0084:Nbeal2 UTSW 9 110643710 critical splice donor site probably null
R0147:Nbeal2 UTSW 9 110642143 nonsense probably null
R0294:Nbeal2 UTSW 9 110632859 missense probably damaging 1.00
R0310:Nbeal2 UTSW 9 110638163 missense probably damaging 1.00
R0494:Nbeal2 UTSW 9 110627187 missense probably damaging 1.00
R0550:Nbeal2 UTSW 9 110642158 missense probably benign 0.01
R0630:Nbeal2 UTSW 9 110636034 splice site probably benign
R0762:Nbeal2 UTSW 9 110643808 splice site probably benign
R0862:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R0864:Nbeal2 UTSW 9 110628195 missense probably damaging 1.00
R1225:Nbeal2 UTSW 9 110632886 missense probably damaging 1.00
R1240:Nbeal2 UTSW 9 110627108 missense probably damaging 0.98
R1450:Nbeal2 UTSW 9 110633672 splice site probably benign
R1519:Nbeal2 UTSW 9 110636305 missense probably damaging 1.00
R1655:Nbeal2 UTSW 9 110632872 missense probably damaging 1.00
R1668:Nbeal2 UTSW 9 110638893 missense probably damaging 1.00
R1705:Nbeal2 UTSW 9 110625196 missense probably damaging 1.00
R1784:Nbeal2 UTSW 9 110630857 nonsense probably null
R1834:Nbeal2 UTSW 9 110627129 missense probably damaging 1.00
R1997:Nbeal2 UTSW 9 110632198 missense probably damaging 1.00
R2013:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2014:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2055:Nbeal2 UTSW 9 110635307 missense possibly damaging 0.92
R2086:Nbeal2 UTSW 9 110634071 missense probably benign 0.09
R2113:Nbeal2 UTSW 9 110625406 missense probably damaging 1.00
R2167:Nbeal2 UTSW 9 110638308 missense probably damaging 1.00
R2201:Nbeal2 UTSW 9 110630250 missense probably benign 0.16
R2309:Nbeal2 UTSW 9 110626570 missense probably damaging 1.00
R2378:Nbeal2 UTSW 9 110630808 missense probably damaging 0.99
R2945:Nbeal2 UTSW 9 110628068 missense possibly damaging 0.82
R3052:Nbeal2 UTSW 9 110633085 missense possibly damaging 0.93
R3076:Nbeal2 UTSW 9 110631700 missense probably damaging 1.00
R3176:Nbeal2 UTSW 9 110636887 splice site probably benign
R3974:Nbeal2 UTSW 9 110633846 missense probably damaging 1.00
R4183:Nbeal2 UTSW 9 110636675 missense probably benign
R4342:Nbeal2 UTSW 9 110631793 intron probably benign
R4654:Nbeal2 UTSW 9 110632004 missense probably damaging 1.00
R4707:Nbeal2 UTSW 9 110632055 missense probably benign 0.10
R4822:Nbeal2 UTSW 9 110636315 missense possibly damaging 0.82
R4854:Nbeal2 UTSW 9 110631396 missense probably damaging 1.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4860:Nbeal2 UTSW 9 110635194 missense probably benign 0.00
R4990:Nbeal2 UTSW 9 110634803 missense probably benign 0.10
R4991:Nbeal2 UTSW 9 110638767 missense probably damaging 1.00
R5021:Nbeal2 UTSW 9 110637463 missense probably damaging 0.99
R5057:Nbeal2 UTSW 9 110631005 missense probably damaging 1.00
R5092:Nbeal2 UTSW 9 110626728 splice site probably null
R5161:Nbeal2 UTSW 9 110629868 missense probably benign
R5202:Nbeal2 UTSW 9 110644666 missense probably damaging 0.99
R5217:Nbeal2 UTSW 9 110632090 missense possibly damaging 0.56
R5408:Nbeal2 UTSW 9 110637520 missense possibly damaging 0.91
R5540:Nbeal2 UTSW 9 110631733 missense probably damaging 1.00
R5866:Nbeal2 UTSW 9 110631492 missense probably damaging 1.00
R5925:Nbeal2 UTSW 9 110629880 missense probably benign 0.00
R6057:Nbeal2 UTSW 9 110641877 missense possibly damaging 0.81
R6180:Nbeal2 UTSW 9 110625147 missense probably damaging 1.00
R6191:Nbeal2 UTSW 9 110627990 critical splice donor site probably null
R6232:Nbeal2 UTSW 9 110638734 missense probably damaging 1.00
R6372:Nbeal2 UTSW 9 110628744 missense possibly damaging 0.69
R6423:Nbeal2 UTSW 9 110625994 missense probably damaging 1.00
R6543:Nbeal2 UTSW 9 110644458 missense probably benign
R6648:Nbeal2 UTSW 9 110637642 missense probably damaging 1.00
R6722:Nbeal2 UTSW 9 110632992 missense probably damaging 1.00
R6738:Nbeal2 UTSW 9 110636905 missense possibly damaging 0.93
R6916:Nbeal2 UTSW 9 110626108 missense probably damaging 1.00
R6935:Nbeal2 UTSW 9 110639391 missense probably damaging 1.00
R7022:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7023:Nbeal2 UTSW 9 110638618 missense probably damaging 1.00
R7050:Nbeal2 UTSW 9 110628720 missense probably damaging 1.00
R7072:Nbeal2 UTSW 9 110626051 missense probably benign 0.01
R7073:Nbeal2 UTSW 9 110626109 missense probably damaging 0.99
R7099:Nbeal2 UTSW 9 110645438 intron probably null
R7354:Nbeal2 UTSW 9 110629179 missense probably damaging 1.00
R7394:Nbeal2 UTSW 9 110630189 critical splice donor site probably null
R7397:Nbeal2 UTSW 9 110628032 missense possibly damaging 0.78
R7552:Nbeal2 UTSW 9 110653917 missense probably benign 0.16
R7619:Nbeal2 UTSW 9 110625818 missense probably benign 0.19
R7902:Nbeal2 UTSW 9 110637547 missense probably benign
R7985:Nbeal2 UTSW 9 110637547 missense probably benign
V7583:Nbeal2 UTSW 9 110637937 missense possibly damaging 0.65
X0017:Nbeal2 UTSW 9 110644278 missense probably benign 0.02
X0065:Nbeal2 UTSW 9 110644413 splice site probably benign
Z1088:Nbeal2 UTSW 9 110632372 missense possibly damaging 0.51
Z1176:Nbeal2 UTSW 9 110625816 missense not run
Z1176:Nbeal2 UTSW 9 110638835 missense not run
Z1177:Nbeal2 UTSW 9 110629854 missense not run
Predicted Primers PCR Primer
(F):5'- TGAAGAAGAGTTCGAGCGCC -3'
(R):5'- CATGTGACCTCATGGCTCAC -3'

Sequencing Primer
(F):5'- CAGGTTGAAACGCCGCAG -3'
(R):5'- GTGACCTCATGGCTCACTGGTC -3'
Posted On2019-12-03