Incidental Mutation 'R7821:4921530L21Rik'
ID601891
Institutional Source Beutler Lab
Gene Symbol 4921530L21Rik
Ensembl Gene ENSMUSG00000034689
Gene NameRIKEN cDNA 4921530L21 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7821 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location95881254-95882780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95882050 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 81 (Q81R)
Ref Sequence ENSEMBL: ENSMUSP00000153934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045892] [ENSMUST00000228913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045892
AA Change: Q81R

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044028
Gene: ENSMUSG00000034689
AA Change: Q81R

DomainStartEndE-ValueType
coiled coil region 36 62 N/A INTRINSIC
coiled coil region 127 175 N/A INTRINSIC
coiled coil region 200 245 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228913
AA Change: Q81R

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,592,888 V560A possibly damaging Het
Aass T A 6: 23,120,930 T112S probably damaging Het
Abca12 G T 1: 71,259,791 S2320R probably benign Het
Abca7 TGGTGCGTGAG TG 10: 80,002,590 probably benign Het
Adh7 T A 3: 138,226,375 I250N probably damaging Het
Aoc1 T A 6: 48,905,811 I229N probably damaging Het
C2cd6 A T 1: 59,067,792 Y291* probably null Het
Cacnb4 T C 2: 52,434,508 D514G possibly damaging Het
Clec2g A G 6: 128,948,777 T50A probably benign Het
Col6a5 T C 9: 105,864,259 E2487G probably damaging Het
D130040H23Rik A T 8: 69,300,235 probably null Het
D6Ertd527e G A 6: 87,110,897 S14N unknown Het
Dchs1 G A 7: 105,765,145 T821I probably benign Het
Dhcr24 T C 4: 106,571,436 S138P possibly damaging Het
Dhrs9 G A 2: 69,394,438 G157R probably damaging Het
Dnah5 T A 15: 28,411,532 D3682E possibly damaging Het
Dst T C 1: 34,275,362 probably null Het
Fat1 A T 8: 44,950,224 H4L probably benign Het
Flnb A G 14: 7,939,113 I2319V probably benign Het
Foxe1 T C 4: 46,344,578 W129R probably damaging Het
Foxred2 G A 15: 77,943,350 P603L probably benign Het
Fshr A G 17: 88,986,213 S346P probably damaging Het
Galnt2 T A 8: 124,343,395 S550R possibly damaging Het
Gpc2 A G 5: 138,276,297 S312P probably benign Het
Gpr150 C A 13: 76,056,392 A145S probably benign Het
Grk4 T A 5: 34,710,209 W173R probably damaging Het
Hoxb9 C G 11: 96,271,711 P57R probably damaging Het
Hsf5 A G 11: 87,638,128 Q563R probably benign Het
Ighv1-58 A G 12: 115,312,176 F114S possibly damaging Het
Klra9 T A 6: 130,185,600 I158F probably damaging Het
Lrrc8d T C 5: 105,812,344 S207P probably damaging Het
Nbeal2 T C 9: 110,630,252 E1929G probably damaging Het
Ncoa1 A G 12: 4,296,221 M89T probably benign Het
Nkx2-4 T C 2: 147,085,288 I20V probably benign Het
Nup214 T C 2: 32,026,905 S1191P possibly damaging Het
Olfr136 A G 17: 38,335,964 D269G probably benign Het
Pfkp T A 13: 6,597,872 N556I probably damaging Het
Pidd1 A T 7: 141,442,280 S199T probably benign Het
Pik3r2 T A 8: 70,769,764 I515F probably damaging Het
Plcxd2 T A 16: 45,965,161 I294F probably damaging Het
Prmt6 C A 3: 110,250,987 probably benign Het
Prpf8 A G 11: 75,494,474 I812V probably benign Het
Rasa2 T C 9: 96,580,484 probably null Het
Rsad1 A C 11: 94,544,462 D266E probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Shroom3 T A 5: 92,940,846 V485E probably damaging Het
Siae T A 9: 37,644,900 Y451N probably damaging Het
Slc7a11 A T 3: 50,381,027 I354N probably damaging Het
Spryd7 A T 14: 61,545,680 probably null Het
Srcap A G 7: 127,530,327 probably benign Het
Svep1 T A 4: 58,179,601 D214V probably damaging Het
Tmtc4 T C 14: 122,971,877 I119V probably benign Het
Trim5 G A 7: 104,278,426 T169I probably benign Het
Ttc33 T C 15: 5,212,025 F83S probably benign Het
Ubr5 A T 15: 37,997,187 S1741T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdcp A G 12: 4,857,975 N694S probably benign Het
Zfp174 T A 16: 3,848,177 I102N probably damaging Het
Zfp354a T C 11: 51,069,712 F248S probably damaging Het
Zfyve26 A T 12: 79,255,324 C404S probably damaging Het
Zmynd8 A T 2: 165,881,080 probably benign Het
Other mutations in 4921530L21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0356:4921530L21Rik UTSW 14 95882365 missense possibly damaging 0.92
R0633:4921530L21Rik UTSW 14 95881943 missense probably damaging 1.00
R1396:4921530L21Rik UTSW 14 95882551 missense probably benign 0.01
R5561:4921530L21Rik UTSW 14 95882371 missense probably benign 0.26
R6956:4921530L21Rik UTSW 14 95882433 missense probably damaging 1.00
R7431:4921530L21Rik UTSW 14 95881837 missense probably benign 0.15
R7436:4921530L21Rik UTSW 14 95882591 missense probably benign
R7689:4921530L21Rik UTSW 14 95881816 missense probably benign
R7720:4921530L21Rik UTSW 14 95882112 missense probably benign 0.04
R7724:4921530L21Rik UTSW 14 95882250 missense possibly damaging 0.95
Z1177:4921530L21Rik UTSW 14 95882130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTCTTGTACCCGAAATCAGAAG -3'
(R):5'- CAGAGCCTTAGCCTCATTCTGG -3'

Sequencing Primer
(F):5'- TTGTACCCGAAATCAGAAGAAACTC -3'
(R):5'- TTAGCCTCATTCTGGAAGGC -3'
Posted On2019-12-03