Incidental Mutation 'R7822:Tgm3'
ID601910
Institutional Source Beutler Lab
Gene Symbol Tgm3
Ensembl Gene ENSMUSG00000027401
Gene Nametransglutaminase 3, E polypeptide
SynonymsTG E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7822 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130012349-130050399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130041899 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 492 (I492M)
Ref Sequence ENSEMBL: ENSMUSP00000105928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110299]
Predicted Effect probably benign
Transcript: ENSMUST00000110299
AA Change: I492M

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105928
Gene: ENSMUSG00000027401
AA Change: I492M

DomainStartEndE-ValueType
Pfam:Transglut_N 5 118 8.3e-33 PFAM
TGc 265 357 6.4e-39 SMART
Pfam:Transglut_C 483 588 3.9e-26 PFAM
Pfam:Transglut_C 595 693 4.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU or null mutation exhibit rough-looking, curly hair. Null mutants display delayed skin barrier formation, loss of vibrissae, and brittle hairs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,880,713 S551L possibly damaging Het
Arhgap8 A C 15: 84,765,732 Y219S probably damaging Het
Ash1l T C 3: 89,007,264 S1734P probably benign Het
Btnl2 T A 17: 34,363,314 S285T possibly damaging Het
Cadm4 A G 7: 24,503,545 D364G possibly damaging Het
Card6 T A 15: 5,098,865 K1016N possibly damaging Het
Ccdc130 T C 8: 84,261,782 E72G probably damaging Het
Cdh2 G T 18: 16,624,284 N692K probably benign Het
Cep76 G T 18: 67,641,149 S9* probably null Het
Cklf T C 8: 104,251,097 probably null Het
Ctsa T C 2: 164,839,232 *475R probably null Het
Dapk1 A C 13: 60,725,901 D406A probably benign Het
Ddx4 A T 13: 112,612,113 V443D probably damaging Het
Dph5 C T 3: 115,899,750 Q106* probably null Het
Drg2 C T 11: 60,462,200 R220* probably null Het
Efcab8 A T 2: 153,810,912 Q509L unknown Het
Efs C T 14: 54,917,450 S444N probably benign Het
Evl T C 12: 108,648,464 V58A probably damaging Het
Fam71b A G 11: 46,404,903 N34S Het
Gbe1 G A 16: 70,433,612 R166H probably damaging Het
Gcc1 T C 6: 28,418,786 E516G probably damaging Het
Ghr T C 15: 3,457,957 T15A probably benign Het
Gnb4 G A 3: 32,596,331 T50M probably damaging Het
Grik3 T C 4: 125,656,397 probably null Het
Gstk1 T C 6: 42,247,752 Y135H probably benign Het
Gucy2c T A 6: 136,708,406 I846F probably damaging Het
Itga7 A G 10: 128,942,966 T321A probably benign Het
Jakmip1 A T 5: 37,175,180 N1068I probably damaging Het
Krt36 A G 11: 100,104,140 I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mast2 A G 4: 116,312,873 L741P probably damaging Het
Mctp2 T C 7: 72,127,187 N720S possibly damaging Het
Mmp9 A T 2: 164,949,036 K115* probably null Het
Mtf2 C T 5: 108,080,877 R20* probably null Het
Mycbp2 T G 14: 103,139,415 Q3810P probably benign Het
Myom2 A T 8: 15,108,454 H802L probably benign Het
Naa25 A G 5: 121,407,213 N27D probably damaging Het
Necab2 T C 8: 119,454,364 F126L probably damaging Het
Nisch C G 14: 31,174,651 probably benign Het
Nsd2 T A 5: 33,843,594 S152T probably damaging Het
Ntsr1 T C 2: 180,538,690 L263P probably damaging Het
Nup210 A G 6: 91,018,777 V922A possibly damaging Het
Olfr109 T A 17: 37,467,103 M299K probably benign Het
Olfr1175-ps A C 2: 88,323,081 I208S probably benign Het
Olfr1458 T A 19: 13,103,053 I84F probably benign Het
Pccb C A 9: 101,027,084 C144F probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prdm1 A G 10: 44,458,482 V16A probably benign Het
Psme4 A G 11: 30,874,245 D1743G probably benign Het
Rad21l G T 2: 151,655,125 D356E probably benign Het
Rars A G 11: 35,819,966 I322T probably damaging Het
Retreg2 C A 1: 75,146,541 P319Q possibly damaging Het
Robo2 T C 16: 73,973,171 Y559C probably damaging Het
Ror1 T C 4: 100,441,367 Y646H probably damaging Het
Rrp15 A G 1: 186,749,176 S45P probably benign Het
Sacs G C 14: 61,192,203 K570N probably benign Het
Serpinb8 C T 1: 107,606,993 Q265* probably null Het
Sgo2b T C 8: 63,927,284 E838G probably damaging Het
Slc2a12 G A 10: 22,664,669 R141K probably damaging Het
Strc G T 2: 121,377,738 T384N probably benign Het
Tcaf2 T C 6: 42,629,099 S547G possibly damaging Het
Tekt5 T C 16: 10,382,928 N243S possibly damaging Het
Tgm7 G A 2: 121,103,940 T157I probably benign Het
Trnp1 C A 4: 133,498,039 R140L possibly damaging Het
Ttn A G 2: 76,779,433 V15797A probably damaging Het
Ugp2 A T 11: 21,333,762 S102T probably benign Het
Vav2 A T 2: 27,282,287 probably null Het
Vmn1r202 T A 13: 22,502,071 I59F probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zscan12 T A 13: 21,369,204 H399Q probably damaging Het
Other mutations in Tgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Tgm3 APN 2 130038413 missense probably damaging 1.00
IGL00924:Tgm3 APN 2 130038374 missense probably damaging 1.00
IGL01469:Tgm3 APN 2 130024494 missense probably damaging 1.00
IGL01722:Tgm3 APN 2 130044568 missense probably damaging 0.99
IGL01787:Tgm3 APN 2 130047740 missense possibly damaging 0.85
IGL02269:Tgm3 APN 2 130024518 missense probably benign 0.02
IGL02437:Tgm3 APN 2 130030041 splice site probably null
IGL02449:Tgm3 APN 2 130038609 critical splice donor site probably null
IGL02992:Tgm3 APN 2 130041979 missense probably damaging 1.00
tortellini UTSW 2 130024585 critical splice donor site probably benign
ANU74:Tgm3 UTSW 2 130048390 missense probably damaging 1.00
R0523:Tgm3 UTSW 2 130044662 critical splice donor site probably null
R0833:Tgm3 UTSW 2 130026682 splice site probably benign
R0834:Tgm3 UTSW 2 130026757 missense probably benign 0.00
R0836:Tgm3 UTSW 2 130026682 splice site probably benign
R0940:Tgm3 UTSW 2 130012406 missense probably benign 0.00
R1354:Tgm3 UTSW 2 130041898 missense probably benign
R1642:Tgm3 UTSW 2 130047782 missense probably damaging 1.00
R1670:Tgm3 UTSW 2 130041768 nonsense probably null
R1715:Tgm3 UTSW 2 130026814 critical splice donor site probably null
R1944:Tgm3 UTSW 2 130029969 missense probably damaging 0.99
R2104:Tgm3 UTSW 2 130037483 missense probably benign 0.39
R3416:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R3417:Tgm3 UTSW 2 130047772 missense possibly damaging 0.84
R4231:Tgm3 UTSW 2 130044589 nonsense probably null
R4296:Tgm3 UTSW 2 130038413 missense possibly damaging 0.77
R4794:Tgm3 UTSW 2 130041955 missense probably benign 0.00
R4948:Tgm3 UTSW 2 130048320 missense probably benign 0.00
R5034:Tgm3 UTSW 2 130037484 missense possibly damaging 0.95
R5144:Tgm3 UTSW 2 130048282 missense possibly damaging 0.95
R5786:Tgm3 UTSW 2 130026784 nonsense probably null
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6030:Tgm3 UTSW 2 130042000 missense probably damaging 1.00
R6182:Tgm3 UTSW 2 130025301 nonsense probably null
R6219:Tgm3 UTSW 2 130038610 critical splice donor site probably null
R6901:Tgm3 UTSW 2 130041970 missense possibly damaging 0.95
R6969:Tgm3 UTSW 2 130042029 missense probably benign 0.06
R6980:Tgm3 UTSW 2 130026777 missense probably benign 0.17
R7282:Tgm3 UTSW 2 130024561 missense probably benign 0.00
R7317:Tgm3 UTSW 2 130048291 missense probably benign 0.09
R7513:Tgm3 UTSW 2 130024404 missense probably benign 0.00
R7517:Tgm3 UTSW 2 130041764 missense probably benign 0.01
R7793:Tgm3 UTSW 2 130012410 critical splice donor site probably null
R7955:Tgm3 UTSW 2 130038480 missense probably benign
X0065:Tgm3 UTSW 2 130024510 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCAGCTATATCTCTGAGGTACCC -3'
(R):5'- ATTGAGTCCCACCAACTACAGG -3'

Sequencing Primer
(F):5'- ATATCTCTGAGGTACCCTTGTTTAG -3'
(R):5'- CAGGATGAGTCAGTTACCTTCTTCAG -3'
Posted On2019-12-03