Incidental Mutation 'R7822:Mmp9'
ID601915
Institutional Source Beutler Lab
Gene Symbol Mmp9
Ensembl Gene ENSMUSG00000017737
Gene Namematrix metallopeptidase 9
Synonymsgelatinase B, MMP-9, Gelatinase B, B/MMP9, Gel B, Clg4b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7822 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164940780-164955850 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 164949036 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 115 (K115*)
Ref Sequence ENSEMBL: ENSMUSP00000017881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017881] [ENSMUST00000137626]
Predicted Effect probably null
Transcript: ENSMUST00000017881
AA Change: K115*
SMART Domains Protein: ENSMUSP00000017881
Gene: ENSMUSG00000017737
AA Change: K115*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 39 95 2.9e-8 PFAM
ZnMc 112 445 3.92e-39 SMART
FN2 223 271 8.08e-29 SMART
FN2 281 329 6.93e-28 SMART
FN2 340 388 9.28e-29 SMART
low complexity region 449 468 N/A INTRINSIC
Pfam:PT 474 508 1.1e-11 PFAM
HX 539 583 2.4e-8 SMART
HX 585 626 9.33e-6 SMART
HX 631 677 2.74e-3 SMART
HX 679 721 1.74e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137626
SMART Domains Protein: ENSMUSP00000120628
Gene: ENSMUSG00000017737

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:1L6J|A 20 67 5e-15 PDB
SCOP:d1l6ja1 29 67 2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme that degrades collagens of type IV, V and XI, and elastin. Mice lacking the encoded protein exhibit an abnormal pattern of skeletal growth plate vascularization and ossification, reduced keratinocyte hyperproliferation at all neoplastic stages, a decreased incidence of invasive tumors, and resistance to experimental autoimmune encephalomyelitis. [provided by RefSeq, Feb 2016]
PHENOTYPE: Null mutants have short long bones with compensatory growth via delayed ossification and apoptosis of hypertrophic chondroctyes. Mutants are protected against ischemic brain injury, damage caused by myocardial infarction, and allergic airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,880,713 S551L possibly damaging Het
Arhgap8 A C 15: 84,765,732 Y219S probably damaging Het
Ash1l T C 3: 89,007,264 S1734P probably benign Het
Btnl2 T A 17: 34,363,314 S285T possibly damaging Het
Cadm4 A G 7: 24,503,545 D364G possibly damaging Het
Card6 T A 15: 5,098,865 K1016N possibly damaging Het
Ccdc130 T C 8: 84,261,782 E72G probably damaging Het
Cdh2 G T 18: 16,624,284 N692K probably benign Het
Cep76 G T 18: 67,641,149 S9* probably null Het
Cklf T C 8: 104,251,097 probably null Het
Ctsa T C 2: 164,839,232 *475R probably null Het
Dapk1 A C 13: 60,725,901 D406A probably benign Het
Ddx4 A T 13: 112,612,113 V443D probably damaging Het
Dph5 C T 3: 115,899,750 Q106* probably null Het
Drg2 C T 11: 60,462,200 R220* probably null Het
Efcab8 A T 2: 153,810,912 Q509L unknown Het
Efs C T 14: 54,917,450 S444N probably benign Het
Evl T C 12: 108,648,464 V58A probably damaging Het
Fam71b A G 11: 46,404,903 N34S Het
Gbe1 G A 16: 70,433,612 R166H probably damaging Het
Gcc1 T C 6: 28,418,786 E516G probably damaging Het
Ghr T C 15: 3,457,957 T15A probably benign Het
Gnb4 G A 3: 32,596,331 T50M probably damaging Het
Grik3 T C 4: 125,656,397 probably null Het
Gstk1 T C 6: 42,247,752 Y135H probably benign Het
Gucy2c T A 6: 136,708,406 I846F probably damaging Het
Itga7 A G 10: 128,942,966 T321A probably benign Het
Jakmip1 A T 5: 37,175,180 N1068I probably damaging Het
Krt36 A G 11: 100,104,140 I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mast2 A G 4: 116,312,873 L741P probably damaging Het
Mctp2 T C 7: 72,127,187 N720S possibly damaging Het
Mtf2 C T 5: 108,080,877 R20* probably null Het
Mycbp2 T G 14: 103,139,415 Q3810P probably benign Het
Myom2 A T 8: 15,108,454 H802L probably benign Het
Naa25 A G 5: 121,407,213 N27D probably damaging Het
Necab2 T C 8: 119,454,364 F126L probably damaging Het
Nisch C G 14: 31,174,651 probably benign Het
Nsd2 T A 5: 33,843,594 S152T probably damaging Het
Ntsr1 T C 2: 180,538,690 L263P probably damaging Het
Nup210 A G 6: 91,018,777 V922A possibly damaging Het
Olfr109 T A 17: 37,467,103 M299K probably benign Het
Olfr1175-ps A C 2: 88,323,081 I208S probably benign Het
Olfr1458 T A 19: 13,103,053 I84F probably benign Het
Pccb C A 9: 101,027,084 C144F probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prdm1 A G 10: 44,458,482 V16A probably benign Het
Psme4 A G 11: 30,874,245 D1743G probably benign Het
Rad21l G T 2: 151,655,125 D356E probably benign Het
Rars A G 11: 35,819,966 I322T probably damaging Het
Retreg2 C A 1: 75,146,541 P319Q possibly damaging Het
Robo2 T C 16: 73,973,171 Y559C probably damaging Het
Ror1 T C 4: 100,441,367 Y646H probably damaging Het
Rrp15 A G 1: 186,749,176 S45P probably benign Het
Sacs G C 14: 61,192,203 K570N probably benign Het
Serpinb8 C T 1: 107,606,993 Q265* probably null Het
Sgo2b T C 8: 63,927,284 E838G probably damaging Het
Slc2a12 G A 10: 22,664,669 R141K probably damaging Het
Strc G T 2: 121,377,738 T384N probably benign Het
Tcaf2 T C 6: 42,629,099 S547G possibly damaging Het
Tekt5 T C 16: 10,382,928 N243S possibly damaging Het
Tgm3 A G 2: 130,041,899 I492M probably benign Het
Tgm7 G A 2: 121,103,940 T157I probably benign Het
Trnp1 C A 4: 133,498,039 R140L possibly damaging Het
Ttn A G 2: 76,779,433 V15797A probably damaging Het
Ugp2 A T 11: 21,333,762 S102T probably benign Het
Vav2 A T 2: 27,282,287 probably null Het
Vmn1r202 T A 13: 22,502,071 I59F probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zscan12 T A 13: 21,369,204 H399Q probably damaging Het
Other mutations in Mmp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Mmp9 APN 2 164949989 missense probably benign 0.13
IGL01980:Mmp9 APN 2 164950916 missense probably benign 0.01
IGL02117:Mmp9 APN 2 164949724 missense probably damaging 1.00
IGL02515:Mmp9 APN 2 164948956 missense probably damaging 1.00
IGL02756:Mmp9 APN 2 164949315 missense probably benign 0.27
IGL02833:Mmp9 APN 2 164949803 missense probably damaging 1.00
IGL02893:Mmp9 APN 2 164949068 splice site probably null
IGL02949:Mmp9 APN 2 164951119 missense probably damaging 1.00
IGL03097:Mmp9 UTSW 2 164950806 intron probably null
R0001:Mmp9 UTSW 2 164948383 missense probably benign 0.02
R0125:Mmp9 UTSW 2 164951257 missense probably damaging 1.00
R0532:Mmp9 UTSW 2 164949820 nonsense probably null
R1300:Mmp9 UTSW 2 164948956 missense probably damaging 1.00
R1341:Mmp9 UTSW 2 164949327 missense probably damaging 1.00
R1366:Mmp9 UTSW 2 164953342 missense probably damaging 1.00
R1711:Mmp9 UTSW 2 164949422 missense probably damaging 1.00
R2138:Mmp9 UTSW 2 164952467 nonsense probably null
R3405:Mmp9 UTSW 2 164949390 missense probably damaging 0.99
R3406:Mmp9 UTSW 2 164949390 missense probably damaging 0.99
R4460:Mmp9 UTSW 2 164949038 missense probably damaging 0.99
R4655:Mmp9 UTSW 2 164951202 missense probably benign 0.29
R5155:Mmp9 UTSW 2 164949066 critical splice donor site probably null
R5309:Mmp9 UTSW 2 164950795 unclassified probably benign
R5355:Mmp9 UTSW 2 164950992 missense possibly damaging 0.76
R5476:Mmp9 UTSW 2 164952494 missense probably benign
R5505:Mmp9 UTSW 2 164953608 missense probably benign 0.34
R5646:Mmp9 UTSW 2 164949050 missense probably benign 0.00
R5725:Mmp9 UTSW 2 164949336 missense possibly damaging 0.93
R6968:Mmp9 UTSW 2 164952940 missense probably benign
R7082:Mmp9 UTSW 2 164948892 missense probably benign 0.25
X0020:Mmp9 UTSW 2 164950373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCTGTGATGTCTCTGCCC -3'
(R):5'- AGCTACACCACGATCGCTTC -3'

Sequencing Primer
(F):5'- ACAGGCATACTTGTACCGCTATGG -3'
(R):5'- GCTTCAAAACACACAGGGCTG -3'
Posted On2019-12-03