Incidental Mutation 'R7822:Ror1'
ID 601920
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Name receptor tyrosine kinase-like orphan receptor 1
Synonyms Ntrkr1, 2810404D04Rik
MMRRC Submission 045876-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7822 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 99952988-100301962 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100298564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 646 (Y646H)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
AlphaFold Q9Z139
Predicted Effect probably damaging
Transcript: ENSMUST00000039630
AA Change: Y646H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: Y646H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,885,524 (GRCm39) S551L possibly damaging Het
Ash1l T C 3: 88,914,571 (GRCm39) S1734P probably benign Het
Btnl2 T A 17: 34,582,288 (GRCm39) S285T possibly damaging Het
Cadm4 A G 7: 24,202,970 (GRCm39) D364G possibly damaging Het
Card6 T A 15: 5,128,347 (GRCm39) K1016N possibly damaging Het
Cdh2 G T 18: 16,757,341 (GRCm39) N692K probably benign Het
Cep76 G T 18: 67,774,219 (GRCm39) S9* probably null Het
Cklf T C 8: 104,977,729 (GRCm39) probably null Het
Ctsa T C 2: 164,681,152 (GRCm39) *475R probably null Het
Dapk1 A C 13: 60,873,715 (GRCm39) D406A probably benign Het
Ddx4 A T 13: 112,748,647 (GRCm39) V443D probably damaging Het
Dph5 C T 3: 115,693,399 (GRCm39) Q106* probably null Het
Drg2 C T 11: 60,353,026 (GRCm39) R220* probably null Het
Efcab8 A T 2: 153,652,832 (GRCm39) Q509L unknown Het
Efs C T 14: 55,154,907 (GRCm39) S444N probably benign Het
Evl T C 12: 108,614,723 (GRCm39) V58A probably damaging Het
Garin3 A G 11: 46,295,730 (GRCm39) N34S Het
Gbe1 G A 16: 70,230,500 (GRCm39) R166H probably damaging Het
Gcc1 T C 6: 28,418,785 (GRCm39) E516G probably damaging Het
Ghr T C 15: 3,487,439 (GRCm39) T15A probably benign Het
Gnb4 G A 3: 32,650,480 (GRCm39) T50M probably damaging Het
Grik3 T C 4: 125,550,190 (GRCm39) probably null Het
Gstk1 T C 6: 42,224,686 (GRCm39) Y135H probably benign Het
Gucy2c T A 6: 136,685,404 (GRCm39) I846F probably damaging Het
Itga7 A G 10: 128,778,835 (GRCm39) T321A probably benign Het
Jakmip1 A T 5: 37,332,524 (GRCm39) N1068I probably damaging Het
Krt36 A G 11: 99,994,966 (GRCm39) I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Mast2 A G 4: 116,170,070 (GRCm39) L741P probably damaging Het
Mctp2 T C 7: 71,776,935 (GRCm39) N720S possibly damaging Het
Mmp9 A T 2: 164,790,956 (GRCm39) K115* probably null Het
Mtf2 C T 5: 108,228,743 (GRCm39) R20* probably null Het
Mycbp2 T G 14: 103,376,851 (GRCm39) Q3810P probably benign Het
Myom2 A T 8: 15,158,454 (GRCm39) H802L probably benign Het
Naa25 A G 5: 121,545,276 (GRCm39) N27D probably damaging Het
Necab2 T C 8: 120,181,103 (GRCm39) F126L probably damaging Het
Nisch C G 14: 30,896,608 (GRCm39) probably benign Het
Nsd2 T A 5: 34,000,938 (GRCm39) S152T probably damaging Het
Ntsr1 T C 2: 180,180,483 (GRCm39) L263P probably damaging Het
Nup210 A G 6: 90,995,759 (GRCm39) V922A possibly damaging Het
Or12d17 T A 17: 37,777,994 (GRCm39) M299K probably benign Het
Or5b105 T A 19: 13,080,417 (GRCm39) I84F probably benign Het
Or5d45 A C 2: 88,153,425 (GRCm39) I208S probably benign Het
Pccb C A 9: 100,909,137 (GRCm39) C144F probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Prdm1 A G 10: 44,334,478 (GRCm39) V16A probably benign Het
Prr5 A C 15: 84,649,933 (GRCm39) Y219S probably damaging Het
Psme4 A G 11: 30,824,245 (GRCm39) D1743G probably benign Het
Rad21l G T 2: 151,497,045 (GRCm39) D356E probably benign Het
Rars1 A G 11: 35,710,793 (GRCm39) I322T probably damaging Het
Retreg2 C A 1: 75,123,185 (GRCm39) P319Q possibly damaging Het
Robo2 T C 16: 73,770,059 (GRCm39) Y559C probably damaging Het
Rrp15 A G 1: 186,481,373 (GRCm39) S45P probably benign Het
Sacs G C 14: 61,429,652 (GRCm39) K570N probably benign Het
Serpinb8 C T 1: 107,534,723 (GRCm39) Q265* probably null Het
Sgo2b T C 8: 64,380,318 (GRCm39) E838G probably damaging Het
Slc2a12 G A 10: 22,540,568 (GRCm39) R141K probably damaging Het
Strc G T 2: 121,208,219 (GRCm39) T384N probably benign Het
Tcaf2 T C 6: 42,606,033 (GRCm39) S547G possibly damaging Het
Tekt5 T C 16: 10,200,792 (GRCm39) N243S possibly damaging Het
Tgm3 A G 2: 129,883,819 (GRCm39) I492M probably benign Het
Tgm7 G A 2: 120,934,421 (GRCm39) T157I probably benign Het
Trnp1 C A 4: 133,225,350 (GRCm39) R140L possibly damaging Het
Ttn A G 2: 76,609,777 (GRCm39) V15797A probably damaging Het
Ugp2 A T 11: 21,283,762 (GRCm39) S102T probably benign Het
Vav2 A T 2: 27,172,299 (GRCm39) probably null Het
Vmn1r202 T A 13: 22,686,241 (GRCm39) I59F probably damaging Het
Yju2b T C 8: 84,988,411 (GRCm39) E72G probably damaging Het
Zfp109 T C 7: 23,928,570 (GRCm39) T288A probably benign Het
Zscan12 T A 13: 21,553,374 (GRCm39) H399Q probably damaging Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100,190,940 (GRCm39) missense probably damaging 1.00
IGL00939:Ror1 APN 4 100,298,423 (GRCm39) missense probably benign 0.01
IGL01408:Ror1 APN 4 100,190,984 (GRCm39) missense probably damaging 1.00
IGL01678:Ror1 APN 4 100,283,165 (GRCm39) missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100,266,968 (GRCm39) missense probably damaging 1.00
IGL01985:Ror1 APN 4 100,283,161 (GRCm39) missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100,298,381 (GRCm39) missense probably damaging 1.00
IGL02634:Ror1 APN 4 100,283,307 (GRCm39) missense probably benign 0.00
IGL02995:Ror1 APN 4 100,191,722 (GRCm39) splice site probably benign
IGL03033:Ror1 APN 4 100,269,092 (GRCm39) missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100,265,142 (GRCm39) splice site probably null
F5770:Ror1 UTSW 4 100,298,130 (GRCm39) missense probably damaging 0.99
R0256:Ror1 UTSW 4 100,266,942 (GRCm39) missense probably benign 0.20
R0417:Ror1 UTSW 4 100,269,197 (GRCm39) missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100,298,717 (GRCm39) missense probably damaging 1.00
R1034:Ror1 UTSW 4 100,190,817 (GRCm39) nonsense probably null
R1278:Ror1 UTSW 4 100,299,075 (GRCm39) missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100,298,334 (GRCm39) missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100,269,306 (GRCm39) missense probably benign
R1441:Ror1 UTSW 4 100,298,180 (GRCm39) missense probably benign
R1544:Ror1 UTSW 4 100,299,183 (GRCm39) missense probably damaging 1.00
R1717:Ror1 UTSW 4 100,160,135 (GRCm39) missense probably benign
R1857:Ror1 UTSW 4 100,298,700 (GRCm39) missense probably damaging 1.00
R2018:Ror1 UTSW 4 100,265,038 (GRCm39) nonsense probably null
R2051:Ror1 UTSW 4 100,265,065 (GRCm39) nonsense probably null
R2127:Ror1 UTSW 4 100,299,290 (GRCm39) missense probably benign
R2132:Ror1 UTSW 4 100,267,222 (GRCm39) missense probably benign 0.35
R2133:Ror1 UTSW 4 100,267,222 (GRCm39) missense probably benign 0.35
R2176:Ror1 UTSW 4 100,299,071 (GRCm39) missense probably damaging 0.99
R2431:Ror1 UTSW 4 100,298,352 (GRCm39) missense probably damaging 1.00
R2896:Ror1 UTSW 4 99,953,477 (GRCm39) missense unknown
R3005:Ror1 UTSW 4 100,298,961 (GRCm39) missense probably damaging 0.99
R3780:Ror1 UTSW 4 100,269,314 (GRCm39) missense probably benign 0.34
R3850:Ror1 UTSW 4 100,299,357 (GRCm39) missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100,265,120 (GRCm39) missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100,265,107 (GRCm39) missense probably damaging 0.99
R4863:Ror1 UTSW 4 100,267,001 (GRCm39) missense probably damaging 0.99
R4871:Ror1 UTSW 4 100,283,195 (GRCm39) missense probably benign
R4990:Ror1 UTSW 4 100,299,161 (GRCm39) missense probably benign
R5023:Ror1 UTSW 4 100,283,129 (GRCm39) missense probably benign 0.01
R5028:Ror1 UTSW 4 100,269,133 (GRCm39) missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100,298,619 (GRCm39) missense probably damaging 1.00
R5294:Ror1 UTSW 4 100,283,135 (GRCm39) missense probably benign 0.00
R5538:Ror1 UTSW 4 100,298,208 (GRCm39) missense probably benign
R6339:Ror1 UTSW 4 100,269,128 (GRCm39) missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100,267,109 (GRCm39) missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100,299,303 (GRCm39) missense probably benign
R6733:Ror1 UTSW 4 100,283,252 (GRCm39) missense probably benign
R7022:Ror1 UTSW 4 100,265,108 (GRCm39) missense probably damaging 1.00
R7054:Ror1 UTSW 4 100,299,436 (GRCm39) missense probably benign 0.00
R7121:Ror1 UTSW 4 100,160,142 (GRCm39) missense probably benign 0.00
R7350:Ror1 UTSW 4 100,283,140 (GRCm39) missense probably benign 0.00
R7492:Ror1 UTSW 4 100,298,256 (GRCm39) missense probably benign 0.22
R7502:Ror1 UTSW 4 100,190,827 (GRCm39) missense probably benign 0.03
R7531:Ror1 UTSW 4 100,298,388 (GRCm39) missense probably damaging 1.00
R7661:Ror1 UTSW 4 100,298,687 (GRCm39) missense probably damaging 1.00
R7831:Ror1 UTSW 4 100,298,295 (GRCm39) missense probably benign 0.01
R8366:Ror1 UTSW 4 100,267,195 (GRCm39) missense possibly damaging 0.91
R8539:Ror1 UTSW 4 100,299,084 (GRCm39) missense possibly damaging 0.71
R8757:Ror1 UTSW 4 100,298,080 (GRCm39) missense probably benign 0.01
R8862:Ror1 UTSW 4 100,191,715 (GRCm39) critical splice donor site probably null
R8913:Ror1 UTSW 4 100,265,027 (GRCm39) missense possibly damaging 0.89
R9382:Ror1 UTSW 4 100,191,709 (GRCm39) missense probably benign 0.00
V7580:Ror1 UTSW 4 100,298,130 (GRCm39) missense probably damaging 0.99
V7583:Ror1 UTSW 4 100,298,130 (GRCm39) missense probably damaging 0.99
X0020:Ror1 UTSW 4 100,283,287 (GRCm39) missense probably benign 0.02
Z1177:Ror1 UTSW 4 100,160,116 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGGACGGTCAAATCCAGC -3'
(R):5'- GAACATGGTAAGAGCTGCCG -3'

Sequencing Primer
(F):5'- CAGCCTGGACCATGGTGATTTC -3'
(R):5'- GCTTCCGCACCATTTCAATCAC -3'
Posted On 2019-12-03