Incidental Mutation 'R7822:Ror1'
ID601920
Institutional Source Beutler Lab
Gene Symbol Ror1
Ensembl Gene ENSMUSG00000035305
Gene Namereceptor tyrosine kinase-like orphan receptor 1
Synonyms2810404D04Rik, Ntrkr1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7822 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location100095791-100444765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100441367 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 646 (Y646H)
Ref Sequence ENSEMBL: ENSMUSP00000048171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039630]
Predicted Effect probably damaging
Transcript: ENSMUST00000039630
AA Change: Y646H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: Y646H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IGc2 70 138 8.37e-15 SMART
Pfam:Fz 170 290 4.9e-13 PFAM
KR 311 393 7.57e-47 SMART
transmembrane domain 404 426 N/A INTRINSIC
TyrKc 473 746 2.46e-137 SMART
low complexity region 753 762 N/A INTRINSIC
low complexity region 817 828 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,880,713 S551L possibly damaging Het
Arhgap8 A C 15: 84,765,732 Y219S probably damaging Het
Ash1l T C 3: 89,007,264 S1734P probably benign Het
Btnl2 T A 17: 34,363,314 S285T possibly damaging Het
Cadm4 A G 7: 24,503,545 D364G possibly damaging Het
Card6 T A 15: 5,098,865 K1016N possibly damaging Het
Ccdc130 T C 8: 84,261,782 E72G probably damaging Het
Cdh2 G T 18: 16,624,284 N692K probably benign Het
Cep76 G T 18: 67,641,149 S9* probably null Het
Cklf T C 8: 104,251,097 probably null Het
Ctsa T C 2: 164,839,232 *475R probably null Het
Dapk1 A C 13: 60,725,901 D406A probably benign Het
Ddx4 A T 13: 112,612,113 V443D probably damaging Het
Dph5 C T 3: 115,899,750 Q106* probably null Het
Drg2 C T 11: 60,462,200 R220* probably null Het
Efcab8 A T 2: 153,810,912 Q509L unknown Het
Efs C T 14: 54,917,450 S444N probably benign Het
Evl T C 12: 108,648,464 V58A probably damaging Het
Fam71b A G 11: 46,404,903 N34S Het
Gbe1 G A 16: 70,433,612 R166H probably damaging Het
Gcc1 T C 6: 28,418,786 E516G probably damaging Het
Ghr T C 15: 3,457,957 T15A probably benign Het
Gnb4 G A 3: 32,596,331 T50M probably damaging Het
Grik3 T C 4: 125,656,397 probably null Het
Gstk1 T C 6: 42,247,752 Y135H probably benign Het
Gucy2c T A 6: 136,708,406 I846F probably damaging Het
Itga7 A G 10: 128,942,966 T321A probably benign Het
Jakmip1 A T 5: 37,175,180 N1068I probably damaging Het
Krt36 A G 11: 100,104,140 I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mast2 A G 4: 116,312,873 L741P probably damaging Het
Mctp2 T C 7: 72,127,187 N720S possibly damaging Het
Mmp9 A T 2: 164,949,036 K115* probably null Het
Mtf2 C T 5: 108,080,877 R20* probably null Het
Mycbp2 T G 14: 103,139,415 Q3810P probably benign Het
Myom2 A T 8: 15,108,454 H802L probably benign Het
Naa25 A G 5: 121,407,213 N27D probably damaging Het
Necab2 T C 8: 119,454,364 F126L probably damaging Het
Nisch C G 14: 31,174,651 probably benign Het
Nsd2 T A 5: 33,843,594 S152T probably damaging Het
Ntsr1 T C 2: 180,538,690 L263P probably damaging Het
Nup210 A G 6: 91,018,777 V922A possibly damaging Het
Olfr109 T A 17: 37,467,103 M299K probably benign Het
Olfr1175-ps A C 2: 88,323,081 I208S probably benign Het
Olfr1458 T A 19: 13,103,053 I84F probably benign Het
Pccb C A 9: 101,027,084 C144F probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prdm1 A G 10: 44,458,482 V16A probably benign Het
Psme4 A G 11: 30,874,245 D1743G probably benign Het
Rad21l G T 2: 151,655,125 D356E probably benign Het
Rars A G 11: 35,819,966 I322T probably damaging Het
Retreg2 C A 1: 75,146,541 P319Q possibly damaging Het
Robo2 T C 16: 73,973,171 Y559C probably damaging Het
Rrp15 A G 1: 186,749,176 S45P probably benign Het
Sacs G C 14: 61,192,203 K570N probably benign Het
Serpinb8 C T 1: 107,606,993 Q265* probably null Het
Sgo2b T C 8: 63,927,284 E838G probably damaging Het
Slc2a12 G A 10: 22,664,669 R141K probably damaging Het
Strc G T 2: 121,377,738 T384N probably benign Het
Tcaf2 T C 6: 42,629,099 S547G possibly damaging Het
Tekt5 T C 16: 10,382,928 N243S possibly damaging Het
Tgm3 A G 2: 130,041,899 I492M probably benign Het
Tgm7 G A 2: 121,103,940 T157I probably benign Het
Trnp1 C A 4: 133,498,039 R140L possibly damaging Het
Ttn A G 2: 76,779,433 V15797A probably damaging Het
Ugp2 A T 11: 21,333,762 S102T probably benign Het
Vav2 A T 2: 27,282,287 probably null Het
Vmn1r202 T A 13: 22,502,071 I59F probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zscan12 T A 13: 21,369,204 H399Q probably damaging Het
Other mutations in Ror1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Ror1 APN 4 100333743 missense probably damaging 1.00
IGL00939:Ror1 APN 4 100441226 missense probably benign 0.01
IGL01408:Ror1 APN 4 100333787 missense probably damaging 1.00
IGL01678:Ror1 APN 4 100425968 missense possibly damaging 0.68
IGL01700:Ror1 APN 4 100409771 missense probably damaging 1.00
IGL01985:Ror1 APN 4 100425964 missense possibly damaging 0.94
IGL02002:Ror1 APN 4 100441184 missense probably damaging 1.00
IGL02634:Ror1 APN 4 100426110 missense probably benign 0.00
IGL02995:Ror1 APN 4 100334525 splice site probably benign
IGL03033:Ror1 APN 4 100411895 missense possibly damaging 0.67
IGL03207:Ror1 APN 4 100407945 splice site probably null
F5770:Ror1 UTSW 4 100440933 missense probably damaging 0.99
R0256:Ror1 UTSW 4 100409745 missense probably benign 0.20
R0417:Ror1 UTSW 4 100412000 missense possibly damaging 0.94
R0525:Ror1 UTSW 4 100441520 missense probably damaging 1.00
R1034:Ror1 UTSW 4 100333620 nonsense probably null
R1278:Ror1 UTSW 4 100441878 missense possibly damaging 0.69
R1368:Ror1 UTSW 4 100441137 missense possibly damaging 0.94
R1437:Ror1 UTSW 4 100412109 missense probably benign
R1441:Ror1 UTSW 4 100440983 missense probably benign
R1544:Ror1 UTSW 4 100441986 missense probably damaging 1.00
R1717:Ror1 UTSW 4 100302938 missense probably benign
R1857:Ror1 UTSW 4 100441503 missense probably damaging 1.00
R2018:Ror1 UTSW 4 100407841 nonsense probably null
R2051:Ror1 UTSW 4 100407868 nonsense probably null
R2127:Ror1 UTSW 4 100442093 missense probably benign
R2132:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2133:Ror1 UTSW 4 100410025 missense probably benign 0.35
R2176:Ror1 UTSW 4 100441874 missense probably damaging 0.99
R2431:Ror1 UTSW 4 100441155 missense probably damaging 1.00
R2896:Ror1 UTSW 4 100096280 missense unknown
R3005:Ror1 UTSW 4 100441764 missense probably damaging 0.99
R3780:Ror1 UTSW 4 100412117 missense probably benign 0.34
R3850:Ror1 UTSW 4 100442160 missense possibly damaging 0.90
R3861:Ror1 UTSW 4 100407923 missense possibly damaging 0.46
R4599:Ror1 UTSW 4 100407910 missense probably damaging 0.99
R4863:Ror1 UTSW 4 100409804 missense probably damaging 0.99
R4871:Ror1 UTSW 4 100425998 missense probably benign
R4990:Ror1 UTSW 4 100441964 missense probably benign
R5023:Ror1 UTSW 4 100425932 missense probably benign 0.01
R5028:Ror1 UTSW 4 100411936 missense possibly damaging 0.67
R5079:Ror1 UTSW 4 100441422 missense probably damaging 1.00
R5294:Ror1 UTSW 4 100425938 missense probably benign 0.00
R5538:Ror1 UTSW 4 100441011 missense probably benign
R6339:Ror1 UTSW 4 100411931 missense possibly damaging 0.91
R6491:Ror1 UTSW 4 100409912 missense possibly damaging 0.94
R6632:Ror1 UTSW 4 100442106 missense probably benign
R6733:Ror1 UTSW 4 100426055 missense probably benign
R7022:Ror1 UTSW 4 100407911 missense probably damaging 1.00
R7054:Ror1 UTSW 4 100442239 missense probably benign 0.00
R7121:Ror1 UTSW 4 100302945 missense probably benign 0.00
R7350:Ror1 UTSW 4 100425943 missense probably benign 0.00
R7492:Ror1 UTSW 4 100441059 missense probably benign 0.22
R7502:Ror1 UTSW 4 100333630 missense probably benign 0.03
R7531:Ror1 UTSW 4 100441191 missense probably damaging 1.00
R7661:Ror1 UTSW 4 100441490 missense probably damaging 1.00
R7831:Ror1 UTSW 4 100441098 missense probably benign 0.01
R7914:Ror1 UTSW 4 100441098 missense probably benign 0.01
V7580:Ror1 UTSW 4 100440933 missense probably damaging 0.99
V7583:Ror1 UTSW 4 100440933 missense probably damaging 0.99
X0020:Ror1 UTSW 4 100426090 missense probably benign 0.02
Z1177:Ror1 UTSW 4 100302919 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGGACGGTCAAATCCAGC -3'
(R):5'- GAACATGGTAAGAGCTGCCG -3'

Sequencing Primer
(F):5'- CAGCCTGGACCATGGTGATTTC -3'
(R):5'- GCTTCCGCACCATTTCAATCAC -3'
Posted On2019-12-03