Incidental Mutation 'R7822:Grik3'
ID601922
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Nameglutamate receptor, ionotropic, kainate 3
SynonymsGlur7, Glur-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7822 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location125490700-125714173 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 125656397 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
Predicted Effect probably null
Transcript: ENSMUST00000030676
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,880,713 S551L possibly damaging Het
Arhgap8 A C 15: 84,765,732 Y219S probably damaging Het
Ash1l T C 3: 89,007,264 S1734P probably benign Het
Btnl2 T A 17: 34,363,314 S285T possibly damaging Het
Cadm4 A G 7: 24,503,545 D364G possibly damaging Het
Card6 T A 15: 5,098,865 K1016N possibly damaging Het
Ccdc130 T C 8: 84,261,782 E72G probably damaging Het
Cdh2 G T 18: 16,624,284 N692K probably benign Het
Cep76 G T 18: 67,641,149 S9* probably null Het
Cklf T C 8: 104,251,097 probably null Het
Ctsa T C 2: 164,839,232 *475R probably null Het
Dapk1 A C 13: 60,725,901 D406A probably benign Het
Ddx4 A T 13: 112,612,113 V443D probably damaging Het
Dph5 C T 3: 115,899,750 Q106* probably null Het
Drg2 C T 11: 60,462,200 R220* probably null Het
Efcab8 A T 2: 153,810,912 Q509L unknown Het
Efs C T 14: 54,917,450 S444N probably benign Het
Evl T C 12: 108,648,464 V58A probably damaging Het
Fam71b A G 11: 46,404,903 N34S Het
Gbe1 G A 16: 70,433,612 R166H probably damaging Het
Gcc1 T C 6: 28,418,786 E516G probably damaging Het
Ghr T C 15: 3,457,957 T15A probably benign Het
Gnb4 G A 3: 32,596,331 T50M probably damaging Het
Gstk1 T C 6: 42,247,752 Y135H probably benign Het
Gucy2c T A 6: 136,708,406 I846F probably damaging Het
Itga7 A G 10: 128,942,966 T321A probably benign Het
Jakmip1 A T 5: 37,175,180 N1068I probably damaging Het
Krt36 A G 11: 100,104,140 I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mast2 A G 4: 116,312,873 L741P probably damaging Het
Mctp2 T C 7: 72,127,187 N720S possibly damaging Het
Mmp9 A T 2: 164,949,036 K115* probably null Het
Mtf2 C T 5: 108,080,877 R20* probably null Het
Mycbp2 T G 14: 103,139,415 Q3810P probably benign Het
Myom2 A T 8: 15,108,454 H802L probably benign Het
Naa25 A G 5: 121,407,213 N27D probably damaging Het
Necab2 T C 8: 119,454,364 F126L probably damaging Het
Nisch C G 14: 31,174,651 probably benign Het
Nsd2 T A 5: 33,843,594 S152T probably damaging Het
Ntsr1 T C 2: 180,538,690 L263P probably damaging Het
Nup210 A G 6: 91,018,777 V922A possibly damaging Het
Olfr109 T A 17: 37,467,103 M299K probably benign Het
Olfr1175-ps A C 2: 88,323,081 I208S probably benign Het
Olfr1458 T A 19: 13,103,053 I84F probably benign Het
Pccb C A 9: 101,027,084 C144F probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prdm1 A G 10: 44,458,482 V16A probably benign Het
Psme4 A G 11: 30,874,245 D1743G probably benign Het
Rad21l G T 2: 151,655,125 D356E probably benign Het
Rars A G 11: 35,819,966 I322T probably damaging Het
Retreg2 C A 1: 75,146,541 P319Q possibly damaging Het
Robo2 T C 16: 73,973,171 Y559C probably damaging Het
Ror1 T C 4: 100,441,367 Y646H probably damaging Het
Rrp15 A G 1: 186,749,176 S45P probably benign Het
Sacs G C 14: 61,192,203 K570N probably benign Het
Serpinb8 C T 1: 107,606,993 Q265* probably null Het
Sgo2b T C 8: 63,927,284 E838G probably damaging Het
Slc2a12 G A 10: 22,664,669 R141K probably damaging Het
Strc G T 2: 121,377,738 T384N probably benign Het
Tcaf2 T C 6: 42,629,099 S547G possibly damaging Het
Tekt5 T C 16: 10,382,928 N243S possibly damaging Het
Tgm3 A G 2: 130,041,899 I492M probably benign Het
Tgm7 G A 2: 121,103,940 T157I probably benign Het
Trnp1 C A 4: 133,498,039 R140L possibly damaging Het
Ttn A G 2: 76,779,433 V15797A probably damaging Het
Ugp2 A T 11: 21,333,762 S102T probably benign Het
Vav2 A T 2: 27,282,287 probably null Het
Vmn1r202 T A 13: 22,502,071 I59F probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zscan12 T A 13: 21,369,204 H399Q probably damaging Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125632415 missense probably benign
IGL01534:Grik3 APN 4 125686190 missense probably damaging 1.00
IGL01538:Grik3 APN 4 125694036 missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125623502 missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125685990 splice site probably benign
IGL02475:Grik3 APN 4 125650517 missense probably benign
IGL03198:Grik3 APN 4 125659762 missense probably benign 0.25
IGL03307:Grik3 APN 4 125641554 missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0116:Grik3 UTSW 4 125670556 missense probably benign 0.01
R0208:Grik3 UTSW 4 125686165 missense probably damaging 1.00
R0497:Grik3 UTSW 4 125623510 missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125704564 splice site probably benign
R1296:Grik3 UTSW 4 125704564 splice site probably benign
R1515:Grik3 UTSW 4 125670728 missense probably benign 0.37
R1559:Grik3 UTSW 4 125707997 missense probably benign 0.16
R1617:Grik3 UTSW 4 125691192 missense probably benign
R1848:Grik3 UTSW 4 125694138 missense probably damaging 1.00
R2903:Grik3 UTSW 4 125670644 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3842:Grik3 UTSW 4 125693954 splice site probably benign
R4649:Grik3 UTSW 4 125650485 missense probably damaging 1.00
R4841:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R4842:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R5093:Grik3 UTSW 4 125670589 missense probably benign
R5318:Grik3 UTSW 4 125694136 missense probably damaging 0.96
R5549:Grik3 UTSW 4 125686045 missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125705123 missense probably damaging 0.99
R6226:Grik3 UTSW 4 125659789 missense probably benign 0.04
R6306:Grik3 UTSW 4 125632412 missense probably benign 0.01
R6672:Grik3 UTSW 4 125623516 missense probably benign 0.08
R6682:Grik3 UTSW 4 125650466 missense probably damaging 1.00
R6783:Grik3 UTSW 4 125632300 missense probably benign 0.01
R7390:Grik3 UTSW 4 125649739 missense probably damaging 1.00
R7604:Grik3 UTSW 4 125623635 missense probably damaging 0.97
R7790:Grik3 UTSW 4 125686019 missense probably damaging 1.00
R7952:Grik3 UTSW 4 125704547 missense probably damaging 1.00
R8418:Grik3 UTSW 4 125686042 missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125656373 missense probably damaging 1.00
Z1177:Grik3 UTSW 4 125650506 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TATGGAAATCGCTGGCTCGC -3'
(R):5'- TGTAACAGGACCCCACAGTC -3'

Sequencing Primer
(F):5'- AATCATGGTCTTGGGGGAACAGTATC -3'
(R):5'- AGGACCCCACAGTCTCCTCTG -3'
Posted On2019-12-03