Incidental Mutation 'R7822:Grik3'
ID 601922
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission 045876-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R7822 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 125384493-125607966 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 125550190 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably null
Transcript: ENSMUST00000030676
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,885,524 (GRCm39) S551L possibly damaging Het
Ash1l T C 3: 88,914,571 (GRCm39) S1734P probably benign Het
Btnl2 T A 17: 34,582,288 (GRCm39) S285T possibly damaging Het
Cadm4 A G 7: 24,202,970 (GRCm39) D364G possibly damaging Het
Card6 T A 15: 5,128,347 (GRCm39) K1016N possibly damaging Het
Cdh2 G T 18: 16,757,341 (GRCm39) N692K probably benign Het
Cep76 G T 18: 67,774,219 (GRCm39) S9* probably null Het
Cklf T C 8: 104,977,729 (GRCm39) probably null Het
Ctsa T C 2: 164,681,152 (GRCm39) *475R probably null Het
Dapk1 A C 13: 60,873,715 (GRCm39) D406A probably benign Het
Ddx4 A T 13: 112,748,647 (GRCm39) V443D probably damaging Het
Dph5 C T 3: 115,693,399 (GRCm39) Q106* probably null Het
Drg2 C T 11: 60,353,026 (GRCm39) R220* probably null Het
Efcab8 A T 2: 153,652,832 (GRCm39) Q509L unknown Het
Efs C T 14: 55,154,907 (GRCm39) S444N probably benign Het
Evl T C 12: 108,614,723 (GRCm39) V58A probably damaging Het
Garin3 A G 11: 46,295,730 (GRCm39) N34S Het
Gbe1 G A 16: 70,230,500 (GRCm39) R166H probably damaging Het
Gcc1 T C 6: 28,418,785 (GRCm39) E516G probably damaging Het
Ghr T C 15: 3,487,439 (GRCm39) T15A probably benign Het
Gnb4 G A 3: 32,650,480 (GRCm39) T50M probably damaging Het
Gstk1 T C 6: 42,224,686 (GRCm39) Y135H probably benign Het
Gucy2c T A 6: 136,685,404 (GRCm39) I846F probably damaging Het
Itga7 A G 10: 128,778,835 (GRCm39) T321A probably benign Het
Jakmip1 A T 5: 37,332,524 (GRCm39) N1068I probably damaging Het
Krt36 A G 11: 99,994,966 (GRCm39) I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Mast2 A G 4: 116,170,070 (GRCm39) L741P probably damaging Het
Mctp2 T C 7: 71,776,935 (GRCm39) N720S possibly damaging Het
Mmp9 A T 2: 164,790,956 (GRCm39) K115* probably null Het
Mtf2 C T 5: 108,228,743 (GRCm39) R20* probably null Het
Mycbp2 T G 14: 103,376,851 (GRCm39) Q3810P probably benign Het
Myom2 A T 8: 15,158,454 (GRCm39) H802L probably benign Het
Naa25 A G 5: 121,545,276 (GRCm39) N27D probably damaging Het
Necab2 T C 8: 120,181,103 (GRCm39) F126L probably damaging Het
Nisch C G 14: 30,896,608 (GRCm39) probably benign Het
Nsd2 T A 5: 34,000,938 (GRCm39) S152T probably damaging Het
Ntsr1 T C 2: 180,180,483 (GRCm39) L263P probably damaging Het
Nup210 A G 6: 90,995,759 (GRCm39) V922A possibly damaging Het
Or12d17 T A 17: 37,777,994 (GRCm39) M299K probably benign Het
Or5b105 T A 19: 13,080,417 (GRCm39) I84F probably benign Het
Or5d45 A C 2: 88,153,425 (GRCm39) I208S probably benign Het
Pccb C A 9: 100,909,137 (GRCm39) C144F probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Prdm1 A G 10: 44,334,478 (GRCm39) V16A probably benign Het
Prr5 A C 15: 84,649,933 (GRCm39) Y219S probably damaging Het
Psme4 A G 11: 30,824,245 (GRCm39) D1743G probably benign Het
Rad21l G T 2: 151,497,045 (GRCm39) D356E probably benign Het
Rars1 A G 11: 35,710,793 (GRCm39) I322T probably damaging Het
Retreg2 C A 1: 75,123,185 (GRCm39) P319Q possibly damaging Het
Robo2 T C 16: 73,770,059 (GRCm39) Y559C probably damaging Het
Ror1 T C 4: 100,298,564 (GRCm39) Y646H probably damaging Het
Rrp15 A G 1: 186,481,373 (GRCm39) S45P probably benign Het
Sacs G C 14: 61,429,652 (GRCm39) K570N probably benign Het
Serpinb8 C T 1: 107,534,723 (GRCm39) Q265* probably null Het
Sgo2b T C 8: 64,380,318 (GRCm39) E838G probably damaging Het
Slc2a12 G A 10: 22,540,568 (GRCm39) R141K probably damaging Het
Strc G T 2: 121,208,219 (GRCm39) T384N probably benign Het
Tcaf2 T C 6: 42,606,033 (GRCm39) S547G possibly damaging Het
Tekt5 T C 16: 10,200,792 (GRCm39) N243S possibly damaging Het
Tgm3 A G 2: 129,883,819 (GRCm39) I492M probably benign Het
Tgm7 G A 2: 120,934,421 (GRCm39) T157I probably benign Het
Trnp1 C A 4: 133,225,350 (GRCm39) R140L possibly damaging Het
Ttn A G 2: 76,609,777 (GRCm39) V15797A probably damaging Het
Ugp2 A T 11: 21,283,762 (GRCm39) S102T probably benign Het
Vav2 A T 2: 27,172,299 (GRCm39) probably null Het
Vmn1r202 T A 13: 22,686,241 (GRCm39) I59F probably damaging Het
Yju2b T C 8: 84,988,411 (GRCm39) E72G probably damaging Het
Zfp109 T C 7: 23,928,570 (GRCm39) T288A probably benign Het
Zscan12 T A 13: 21,553,374 (GRCm39) H399Q probably damaging Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125,526,208 (GRCm39) missense probably benign
IGL01534:Grik3 APN 4 125,579,983 (GRCm39) missense probably damaging 1.00
IGL01538:Grik3 APN 4 125,587,829 (GRCm39) missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125,517,295 (GRCm39) missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125,579,783 (GRCm39) splice site probably benign
IGL02475:Grik3 APN 4 125,544,310 (GRCm39) missense probably benign
IGL03198:Grik3 APN 4 125,553,555 (GRCm39) missense probably benign 0.25
IGL03307:Grik3 APN 4 125,535,347 (GRCm39) missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0116:Grik3 UTSW 4 125,564,349 (GRCm39) missense probably benign 0.01
R0208:Grik3 UTSW 4 125,579,958 (GRCm39) missense probably damaging 1.00
R0497:Grik3 UTSW 4 125,517,303 (GRCm39) missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1296:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1515:Grik3 UTSW 4 125,564,521 (GRCm39) missense probably benign 0.37
R1559:Grik3 UTSW 4 125,601,790 (GRCm39) missense probably benign 0.16
R1617:Grik3 UTSW 4 125,584,985 (GRCm39) missense probably benign
R1848:Grik3 UTSW 4 125,587,931 (GRCm39) missense probably damaging 1.00
R2903:Grik3 UTSW 4 125,564,437 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3842:Grik3 UTSW 4 125,587,747 (GRCm39) splice site probably benign
R4649:Grik3 UTSW 4 125,544,278 (GRCm39) missense probably damaging 1.00
R4841:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R4842:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R5093:Grik3 UTSW 4 125,564,382 (GRCm39) missense probably benign
R5318:Grik3 UTSW 4 125,587,929 (GRCm39) missense probably damaging 0.96
R5549:Grik3 UTSW 4 125,579,838 (GRCm39) missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125,598,916 (GRCm39) missense probably damaging 0.99
R6226:Grik3 UTSW 4 125,553,582 (GRCm39) missense probably benign 0.04
R6306:Grik3 UTSW 4 125,526,205 (GRCm39) missense probably benign 0.01
R6672:Grik3 UTSW 4 125,517,309 (GRCm39) missense probably benign 0.08
R6682:Grik3 UTSW 4 125,544,259 (GRCm39) missense probably damaging 1.00
R6783:Grik3 UTSW 4 125,526,093 (GRCm39) missense probably benign 0.01
R7390:Grik3 UTSW 4 125,543,532 (GRCm39) missense probably damaging 1.00
R7604:Grik3 UTSW 4 125,517,428 (GRCm39) missense probably damaging 0.97
R7790:Grik3 UTSW 4 125,579,812 (GRCm39) missense probably damaging 1.00
R7952:Grik3 UTSW 4 125,598,340 (GRCm39) missense probably damaging 1.00
R8418:Grik3 UTSW 4 125,579,835 (GRCm39) missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125,550,166 (GRCm39) missense probably damaging 1.00
R9030:Grik3 UTSW 4 125,526,185 (GRCm39) missense probably benign 0.24
R9243:Grik3 UTSW 4 125,601,690 (GRCm39) missense probably benign 0.00
R9792:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
R9793:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
Z1177:Grik3 UTSW 4 125,544,299 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TATGGAAATCGCTGGCTCGC -3'
(R):5'- TGTAACAGGACCCCACAGTC -3'

Sequencing Primer
(F):5'- AATCATGGTCTTGGGGGAACAGTATC -3'
(R):5'- AGGACCCCACAGTCTCCTCTG -3'
Posted On 2019-12-03