Incidental Mutation 'R7822:Mctp2'
ID 601935
Institutional Source Beutler Lab
Gene Symbol Mctp2
Ensembl Gene ENSMUSG00000032776
Gene Name multiple C2 domains, transmembrane 2
Synonyms LOC244049
MMRRC Submission 045876-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R7822 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 71727578-71956356 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71776935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 720 (N720S)
Ref Sequence ENSEMBL: ENSMUSP00000078302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079323] [ENSMUST00000205410]
AlphaFold Q5RJH2
Predicted Effect possibly damaging
Transcript: ENSMUST00000079323
AA Change: N720S

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078302
Gene: ENSMUSG00000032776
AA Change: N720S

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
C2 195 291 7.5e-20 SMART
C2 357 451 1.27e-8 SMART
C2 510 606 5.38e-21 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:PRT_C 723 857 2.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205410
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,885,524 (GRCm39) S551L possibly damaging Het
Ash1l T C 3: 88,914,571 (GRCm39) S1734P probably benign Het
Btnl2 T A 17: 34,582,288 (GRCm39) S285T possibly damaging Het
Cadm4 A G 7: 24,202,970 (GRCm39) D364G possibly damaging Het
Card6 T A 15: 5,128,347 (GRCm39) K1016N possibly damaging Het
Cdh2 G T 18: 16,757,341 (GRCm39) N692K probably benign Het
Cep76 G T 18: 67,774,219 (GRCm39) S9* probably null Het
Cklf T C 8: 104,977,729 (GRCm39) probably null Het
Ctsa T C 2: 164,681,152 (GRCm39) *475R probably null Het
Dapk1 A C 13: 60,873,715 (GRCm39) D406A probably benign Het
Ddx4 A T 13: 112,748,647 (GRCm39) V443D probably damaging Het
Dph5 C T 3: 115,693,399 (GRCm39) Q106* probably null Het
Drg2 C T 11: 60,353,026 (GRCm39) R220* probably null Het
Efcab8 A T 2: 153,652,832 (GRCm39) Q509L unknown Het
Efs C T 14: 55,154,907 (GRCm39) S444N probably benign Het
Evl T C 12: 108,614,723 (GRCm39) V58A probably damaging Het
Garin3 A G 11: 46,295,730 (GRCm39) N34S Het
Gbe1 G A 16: 70,230,500 (GRCm39) R166H probably damaging Het
Gcc1 T C 6: 28,418,785 (GRCm39) E516G probably damaging Het
Ghr T C 15: 3,487,439 (GRCm39) T15A probably benign Het
Gnb4 G A 3: 32,650,480 (GRCm39) T50M probably damaging Het
Grik3 T C 4: 125,550,190 (GRCm39) probably null Het
Gstk1 T C 6: 42,224,686 (GRCm39) Y135H probably benign Het
Gucy2c T A 6: 136,685,404 (GRCm39) I846F probably damaging Het
Itga7 A G 10: 128,778,835 (GRCm39) T321A probably benign Het
Jakmip1 A T 5: 37,332,524 (GRCm39) N1068I probably damaging Het
Krt36 A G 11: 99,994,966 (GRCm39) I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Mast2 A G 4: 116,170,070 (GRCm39) L741P probably damaging Het
Mmp9 A T 2: 164,790,956 (GRCm39) K115* probably null Het
Mtf2 C T 5: 108,228,743 (GRCm39) R20* probably null Het
Mycbp2 T G 14: 103,376,851 (GRCm39) Q3810P probably benign Het
Myom2 A T 8: 15,158,454 (GRCm39) H802L probably benign Het
Naa25 A G 5: 121,545,276 (GRCm39) N27D probably damaging Het
Necab2 T C 8: 120,181,103 (GRCm39) F126L probably damaging Het
Nisch C G 14: 30,896,608 (GRCm39) probably benign Het
Nsd2 T A 5: 34,000,938 (GRCm39) S152T probably damaging Het
Ntsr1 T C 2: 180,180,483 (GRCm39) L263P probably damaging Het
Nup210 A G 6: 90,995,759 (GRCm39) V922A possibly damaging Het
Or12d17 T A 17: 37,777,994 (GRCm39) M299K probably benign Het
Or5b105 T A 19: 13,080,417 (GRCm39) I84F probably benign Het
Or5d45 A C 2: 88,153,425 (GRCm39) I208S probably benign Het
Pccb C A 9: 100,909,137 (GRCm39) C144F probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Prdm1 A G 10: 44,334,478 (GRCm39) V16A probably benign Het
Prr5 A C 15: 84,649,933 (GRCm39) Y219S probably damaging Het
Psme4 A G 11: 30,824,245 (GRCm39) D1743G probably benign Het
Rad21l G T 2: 151,497,045 (GRCm39) D356E probably benign Het
Rars1 A G 11: 35,710,793 (GRCm39) I322T probably damaging Het
Retreg2 C A 1: 75,123,185 (GRCm39) P319Q possibly damaging Het
Robo2 T C 16: 73,770,059 (GRCm39) Y559C probably damaging Het
Ror1 T C 4: 100,298,564 (GRCm39) Y646H probably damaging Het
Rrp15 A G 1: 186,481,373 (GRCm39) S45P probably benign Het
Sacs G C 14: 61,429,652 (GRCm39) K570N probably benign Het
Serpinb8 C T 1: 107,534,723 (GRCm39) Q265* probably null Het
Sgo2b T C 8: 64,380,318 (GRCm39) E838G probably damaging Het
Slc2a12 G A 10: 22,540,568 (GRCm39) R141K probably damaging Het
Strc G T 2: 121,208,219 (GRCm39) T384N probably benign Het
Tcaf2 T C 6: 42,606,033 (GRCm39) S547G possibly damaging Het
Tekt5 T C 16: 10,200,792 (GRCm39) N243S possibly damaging Het
Tgm3 A G 2: 129,883,819 (GRCm39) I492M probably benign Het
Tgm7 G A 2: 120,934,421 (GRCm39) T157I probably benign Het
Trnp1 C A 4: 133,225,350 (GRCm39) R140L possibly damaging Het
Ttn A G 2: 76,609,777 (GRCm39) V15797A probably damaging Het
Ugp2 A T 11: 21,283,762 (GRCm39) S102T probably benign Het
Vav2 A T 2: 27,172,299 (GRCm39) probably null Het
Vmn1r202 T A 13: 22,686,241 (GRCm39) I59F probably damaging Het
Yju2b T C 8: 84,988,411 (GRCm39) E72G probably damaging Het
Zfp109 T C 7: 23,928,570 (GRCm39) T288A probably benign Het
Zscan12 T A 13: 21,553,374 (GRCm39) H399Q probably damaging Het
Other mutations in Mctp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Mctp2 APN 7 71,835,563 (GRCm39) missense probably damaging 0.96
IGL01296:Mctp2 APN 7 71,878,274 (GRCm39) missense probably benign 0.03
IGL01509:Mctp2 APN 7 71,909,017 (GRCm39) missense probably benign 0.01
IGL02074:Mctp2 APN 7 71,811,006 (GRCm39) missense probably damaging 0.99
IGL02185:Mctp2 APN 7 71,730,571 (GRCm39) missense probably benign 0.13
IGL02238:Mctp2 APN 7 71,739,953 (GRCm39) nonsense probably null
IGL02707:Mctp2 APN 7 71,909,089 (GRCm39) missense possibly damaging 0.95
IGL02820:Mctp2 APN 7 71,895,290 (GRCm39) missense probably damaging 0.99
IGL02869:Mctp2 APN 7 71,878,219 (GRCm39) critical splice donor site probably null
IGL03354:Mctp2 APN 7 71,810,992 (GRCm39) missense probably benign 0.00
IGL03397:Mctp2 APN 7 71,909,025 (GRCm39) missense probably damaging 0.98
IGL03407:Mctp2 APN 7 71,861,400 (GRCm39) missense probably benign 0.05
trifecta UTSW 7 71,909,079 (GRCm39) missense possibly damaging 0.63
triumvirate UTSW 7 71,861,438 (GRCm39) missense probably damaging 1.00
troika UTSW 7 71,835,568 (GRCm39) missense probably damaging 1.00
F5770:Mctp2 UTSW 7 71,771,499 (GRCm39) splice site probably benign
PIT4131001:Mctp2 UTSW 7 71,740,005 (GRCm39) missense probably damaging 1.00
R0013:Mctp2 UTSW 7 71,879,156 (GRCm39) missense probably benign 0.00
R0079:Mctp2 UTSW 7 71,863,864 (GRCm39) splice site probably benign
R0083:Mctp2 UTSW 7 71,878,264 (GRCm39) missense possibly damaging 0.94
R0173:Mctp2 UTSW 7 71,896,855 (GRCm39) critical splice donor site probably null
R0302:Mctp2 UTSW 7 71,740,012 (GRCm39) missense possibly damaging 0.94
R0533:Mctp2 UTSW 7 71,730,570 (GRCm39) missense probably benign 0.00
R0675:Mctp2 UTSW 7 71,732,918 (GRCm39) missense probably damaging 1.00
R1076:Mctp2 UTSW 7 71,835,615 (GRCm39) critical splice acceptor site probably null
R1222:Mctp2 UTSW 7 71,908,887 (GRCm39) missense probably benign
R1356:Mctp2 UTSW 7 71,814,471 (GRCm39) unclassified probably benign
R1628:Mctp2 UTSW 7 71,861,337 (GRCm39) splice site probably null
R1649:Mctp2 UTSW 7 71,811,006 (GRCm39) missense probably damaging 0.99
R1981:Mctp2 UTSW 7 71,814,446 (GRCm39) missense probably benign 0.01
R2256:Mctp2 UTSW 7 71,835,568 (GRCm39) missense probably damaging 1.00
R2257:Mctp2 UTSW 7 71,835,568 (GRCm39) missense probably damaging 1.00
R2327:Mctp2 UTSW 7 71,861,358 (GRCm39) missense probably damaging 0.99
R2407:Mctp2 UTSW 7 71,850,155 (GRCm39) missense probably benign 0.40
R2471:Mctp2 UTSW 7 71,810,909 (GRCm39) nonsense probably null
R3706:Mctp2 UTSW 7 71,863,859 (GRCm39) splice site probably benign
R4023:Mctp2 UTSW 7 71,739,987 (GRCm39) missense possibly damaging 0.88
R4025:Mctp2 UTSW 7 71,739,987 (GRCm39) missense possibly damaging 0.88
R4176:Mctp2 UTSW 7 71,909,085 (GRCm39) missense probably benign
R4272:Mctp2 UTSW 7 71,909,079 (GRCm39) missense possibly damaging 0.63
R4498:Mctp2 UTSW 7 71,833,599 (GRCm39) missense probably damaging 1.00
R4654:Mctp2 UTSW 7 71,739,942 (GRCm39) missense probably damaging 1.00
R4815:Mctp2 UTSW 7 71,909,097 (GRCm39) missense possibly damaging 0.89
R4946:Mctp2 UTSW 7 71,909,017 (GRCm39) missense probably benign 0.00
R5389:Mctp2 UTSW 7 71,863,835 (GRCm39) missense possibly damaging 0.50
R5682:Mctp2 UTSW 7 71,895,207 (GRCm39) critical splice donor site probably null
R5878:Mctp2 UTSW 7 71,863,856 (GRCm39) missense probably benign 0.01
R5918:Mctp2 UTSW 7 71,878,288 (GRCm39) missense probably damaging 1.00
R5956:Mctp2 UTSW 7 71,908,923 (GRCm39) missense probably benign
R5964:Mctp2 UTSW 7 71,752,925 (GRCm39) missense probably damaging 0.97
R5978:Mctp2 UTSW 7 71,739,936 (GRCm39) missense probably damaging 1.00
R6054:Mctp2 UTSW 7 71,908,851 (GRCm39) missense probably benign
R6475:Mctp2 UTSW 7 71,850,092 (GRCm39) critical splice donor site probably null
R6849:Mctp2 UTSW 7 71,861,466 (GRCm39) missense probably damaging 1.00
R6963:Mctp2 UTSW 7 71,877,804 (GRCm39) missense probably damaging 1.00
R7366:Mctp2 UTSW 7 71,908,962 (GRCm39) missense probably benign 0.00
R7468:Mctp2 UTSW 7 71,861,438 (GRCm39) missense probably damaging 1.00
R7746:Mctp2 UTSW 7 71,835,544 (GRCm39) missense probably benign
R7765:Mctp2 UTSW 7 71,740,079 (GRCm39) splice site probably null
R7984:Mctp2 UTSW 7 71,752,937 (GRCm39) missense possibly damaging 0.94
R8416:Mctp2 UTSW 7 71,852,210 (GRCm39) missense probably benign 0.12
R8678:Mctp2 UTSW 7 71,752,955 (GRCm39) missense probably damaging 1.00
R8819:Mctp2 UTSW 7 71,879,081 (GRCm39) missense probably benign 0.20
R8820:Mctp2 UTSW 7 71,879,081 (GRCm39) missense probably benign 0.20
R8835:Mctp2 UTSW 7 71,852,161 (GRCm39) missense probably benign 0.19
R8897:Mctp2 UTSW 7 71,909,311 (GRCm39) start codon destroyed probably benign 0.27
R8898:Mctp2 UTSW 7 71,752,904 (GRCm39) missense probably damaging 0.99
R9124:Mctp2 UTSW 7 71,909,178 (GRCm39) missense probably damaging 1.00
X0066:Mctp2 UTSW 7 71,909,028 (GRCm39) nonsense probably null
Z1191:Mctp2 UTSW 7 71,835,568 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGGATAAAACACAAGTTCTGC -3'
(R):5'- TCATCAGCCACATGAACGAG -3'

Sequencing Primer
(F):5'- CACAAGTTCTGCAAAATGACTTG -3'
(R):5'- CTCTGTAATTGGAAATGCAGTCG -3'
Posted On 2019-12-03