Incidental Mutation 'R7822:Rars'
ID601947
Institutional Source Beutler Lab
Gene Symbol Rars
Ensembl Gene ENSMUSG00000018848
Gene Namearginyl-tRNA synthetase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7822 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location35808381-35834506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35819966 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 322 (I322T)
Ref Sequence ENSEMBL: ENSMUSP00000018992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018992]
Predicted Effect probably damaging
Transcript: ENSMUST00000018992
AA Change: I322T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018992
Gene: ENSMUSG00000018848
AA Change: I322T

DomainStartEndE-ValueType
Blast:Arg_tRNA_synt_N 16 60 6e-13 BLAST
Arg_tRNA_synt_N 78 166 1.6e-27 SMART
Pfam:tRNA-synt_1d 174 520 1.2e-164 PFAM
DALR_1 534 660 3.12e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Arginyl-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,880,713 S551L possibly damaging Het
Arhgap8 A C 15: 84,765,732 Y219S probably damaging Het
Ash1l T C 3: 89,007,264 S1734P probably benign Het
Btnl2 T A 17: 34,363,314 S285T possibly damaging Het
Cadm4 A G 7: 24,503,545 D364G possibly damaging Het
Card6 T A 15: 5,098,865 K1016N possibly damaging Het
Ccdc130 T C 8: 84,261,782 E72G probably damaging Het
Cdh2 G T 18: 16,624,284 N692K probably benign Het
Cep76 G T 18: 67,641,149 S9* probably null Het
Cklf T C 8: 104,251,097 probably null Het
Ctsa T C 2: 164,839,232 *475R probably null Het
Dapk1 A C 13: 60,725,901 D406A probably benign Het
Ddx4 A T 13: 112,612,113 V443D probably damaging Het
Dph5 C T 3: 115,899,750 Q106* probably null Het
Drg2 C T 11: 60,462,200 R220* probably null Het
Efcab8 A T 2: 153,810,912 Q509L unknown Het
Efs C T 14: 54,917,450 S444N probably benign Het
Evl T C 12: 108,648,464 V58A probably damaging Het
Fam71b A G 11: 46,404,903 N34S Het
Gbe1 G A 16: 70,433,612 R166H probably damaging Het
Gcc1 T C 6: 28,418,786 E516G probably damaging Het
Ghr T C 15: 3,457,957 T15A probably benign Het
Gnb4 G A 3: 32,596,331 T50M probably damaging Het
Grik3 T C 4: 125,656,397 probably null Het
Gstk1 T C 6: 42,247,752 Y135H probably benign Het
Gucy2c T A 6: 136,708,406 I846F probably damaging Het
Itga7 A G 10: 128,942,966 T321A probably benign Het
Jakmip1 A T 5: 37,175,180 N1068I probably damaging Het
Krt36 A G 11: 100,104,140 I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mast2 A G 4: 116,312,873 L741P probably damaging Het
Mctp2 T C 7: 72,127,187 N720S possibly damaging Het
Mmp9 A T 2: 164,949,036 K115* probably null Het
Mtf2 C T 5: 108,080,877 R20* probably null Het
Mycbp2 T G 14: 103,139,415 Q3810P probably benign Het
Myom2 A T 8: 15,108,454 H802L probably benign Het
Naa25 A G 5: 121,407,213 N27D probably damaging Het
Necab2 T C 8: 119,454,364 F126L probably damaging Het
Nisch C G 14: 31,174,651 probably benign Het
Nsd2 T A 5: 33,843,594 S152T probably damaging Het
Ntsr1 T C 2: 180,538,690 L263P probably damaging Het
Nup210 A G 6: 91,018,777 V922A possibly damaging Het
Olfr109 T A 17: 37,467,103 M299K probably benign Het
Olfr1175-ps A C 2: 88,323,081 I208S probably benign Het
Olfr1458 T A 19: 13,103,053 I84F probably benign Het
Pccb C A 9: 101,027,084 C144F probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prdm1 A G 10: 44,458,482 V16A probably benign Het
Psme4 A G 11: 30,874,245 D1743G probably benign Het
Rad21l G T 2: 151,655,125 D356E probably benign Het
Retreg2 C A 1: 75,146,541 P319Q possibly damaging Het
Robo2 T C 16: 73,973,171 Y559C probably damaging Het
Ror1 T C 4: 100,441,367 Y646H probably damaging Het
Rrp15 A G 1: 186,749,176 S45P probably benign Het
Sacs G C 14: 61,192,203 K570N probably benign Het
Serpinb8 C T 1: 107,606,993 Q265* probably null Het
Sgo2b T C 8: 63,927,284 E838G probably damaging Het
Slc2a12 G A 10: 22,664,669 R141K probably damaging Het
Strc G T 2: 121,377,738 T384N probably benign Het
Tcaf2 T C 6: 42,629,099 S547G possibly damaging Het
Tekt5 T C 16: 10,382,928 N243S possibly damaging Het
Tgm3 A G 2: 130,041,899 I492M probably benign Het
Tgm7 G A 2: 121,103,940 T157I probably benign Het
Trnp1 C A 4: 133,498,039 R140L possibly damaging Het
Ttn A G 2: 76,779,433 V15797A probably damaging Het
Ugp2 A T 11: 21,333,762 S102T probably benign Het
Vav2 A T 2: 27,282,287 probably null Het
Vmn1r202 T A 13: 22,502,071 I59F probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zscan12 T A 13: 21,369,204 H399Q probably damaging Het
Other mutations in Rars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Rars APN 11 35825981 splice site probably benign
IGL01672:Rars APN 11 35808553 missense probably damaging 0.99
IGL01721:Rars APN 11 35828664 missense probably damaging 1.00
IGL01887:Rars APN 11 35825995 missense probably benign 0.03
IGL02605:Rars APN 11 35824526 splice site probably benign
IGL03296:Rars APN 11 35816696 nonsense probably null
IGL03354:Rars APN 11 35824475 missense probably damaging 1.00
R0410:Rars UTSW 11 35826020 missense probably damaging 1.00
R1193:Rars UTSW 11 35809326 missense possibly damaging 0.92
R1222:Rars UTSW 11 35809740 missense probably damaging 1.00
R1418:Rars UTSW 11 35809740 missense probably damaging 1.00
R1562:Rars UTSW 11 35821094 critical splice donor site probably null
R1768:Rars UTSW 11 35809638 missense probably damaging 1.00
R1800:Rars UTSW 11 35825995 missense probably benign 0.03
R2055:Rars UTSW 11 35826583 splice site probably benign
R2294:Rars UTSW 11 35817536 splice site probably benign
R4281:Rars UTSW 11 35821224 missense probably damaging 1.00
R4807:Rars UTSW 11 35809146 missense possibly damaging 0.81
R4898:Rars UTSW 11 35808558 missense probably damaging 1.00
R5522:Rars UTSW 11 35817368 nonsense probably null
R5907:Rars UTSW 11 35828648 missense probably damaging 1.00
R6243:Rars UTSW 11 35826547 missense possibly damaging 0.64
R6289:Rars UTSW 11 35826067 missense probably damaging 1.00
R6550:Rars UTSW 11 35833183 missense probably benign 0.00
R6889:Rars UTSW 11 35808486 missense probably damaging 1.00
R7260:Rars UTSW 11 35834454 missense probably benign 0.00
R7682:Rars UTSW 11 35828752 missense probably benign 0.00
R7808:Rars UTSW 11 35828707 missense probably benign
R7856:Rars UTSW 11 35808585 missense probably benign 0.09
R8029:Rars UTSW 11 35821165 missense probably damaging 1.00
Z1177:Rars UTSW 11 35826109 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCTGTAATGAGCGTCACAATC -3'
(R):5'- AGAAACAAGTCAGGGCTACC -3'

Sequencing Primer
(F):5'- GCTGTAATGAGCGTCACAATCATTAG -3'
(R):5'- TGTAAACCAGACTGGCCTTG -3'
Posted On2019-12-03