Incidental Mutation 'R7822:Dapk1'
ID 601955
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Name death associated protein kinase 1
Synonyms DAP-Kinase, D13Ucla1, 2810425C21Rik, 2310039H24Rik
MMRRC Submission 045876-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7822 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 60749761-60911005 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 60873715 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 406 (D406A)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
AlphaFold Q80YE7
Predicted Effect probably benign
Transcript: ENSMUST00000044083
AA Change: D406A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: D406A

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077453
AA Change: D406A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: D406A

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224789
Predicted Effect probably benign
Transcript: ENSMUST00000226059
AA Change: D406A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,885,524 (GRCm39) S551L possibly damaging Het
Ash1l T C 3: 88,914,571 (GRCm39) S1734P probably benign Het
Btnl2 T A 17: 34,582,288 (GRCm39) S285T possibly damaging Het
Cadm4 A G 7: 24,202,970 (GRCm39) D364G possibly damaging Het
Card6 T A 15: 5,128,347 (GRCm39) K1016N possibly damaging Het
Cdh2 G T 18: 16,757,341 (GRCm39) N692K probably benign Het
Cep76 G T 18: 67,774,219 (GRCm39) S9* probably null Het
Cklf T C 8: 104,977,729 (GRCm39) probably null Het
Ctsa T C 2: 164,681,152 (GRCm39) *475R probably null Het
Ddx4 A T 13: 112,748,647 (GRCm39) V443D probably damaging Het
Dph5 C T 3: 115,693,399 (GRCm39) Q106* probably null Het
Drg2 C T 11: 60,353,026 (GRCm39) R220* probably null Het
Efcab8 A T 2: 153,652,832 (GRCm39) Q509L unknown Het
Efs C T 14: 55,154,907 (GRCm39) S444N probably benign Het
Evl T C 12: 108,614,723 (GRCm39) V58A probably damaging Het
Garin3 A G 11: 46,295,730 (GRCm39) N34S Het
Gbe1 G A 16: 70,230,500 (GRCm39) R166H probably damaging Het
Gcc1 T C 6: 28,418,785 (GRCm39) E516G probably damaging Het
Ghr T C 15: 3,487,439 (GRCm39) T15A probably benign Het
Gnb4 G A 3: 32,650,480 (GRCm39) T50M probably damaging Het
Grik3 T C 4: 125,550,190 (GRCm39) probably null Het
Gstk1 T C 6: 42,224,686 (GRCm39) Y135H probably benign Het
Gucy2c T A 6: 136,685,404 (GRCm39) I846F probably damaging Het
Itga7 A G 10: 128,778,835 (GRCm39) T321A probably benign Het
Jakmip1 A T 5: 37,332,524 (GRCm39) N1068I probably damaging Het
Krt36 A G 11: 99,994,966 (GRCm39) I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Mast2 A G 4: 116,170,070 (GRCm39) L741P probably damaging Het
Mctp2 T C 7: 71,776,935 (GRCm39) N720S possibly damaging Het
Mmp9 A T 2: 164,790,956 (GRCm39) K115* probably null Het
Mtf2 C T 5: 108,228,743 (GRCm39) R20* probably null Het
Mycbp2 T G 14: 103,376,851 (GRCm39) Q3810P probably benign Het
Myom2 A T 8: 15,158,454 (GRCm39) H802L probably benign Het
Naa25 A G 5: 121,545,276 (GRCm39) N27D probably damaging Het
Necab2 T C 8: 120,181,103 (GRCm39) F126L probably damaging Het
Nisch C G 14: 30,896,608 (GRCm39) probably benign Het
Nsd2 T A 5: 34,000,938 (GRCm39) S152T probably damaging Het
Ntsr1 T C 2: 180,180,483 (GRCm39) L263P probably damaging Het
Nup210 A G 6: 90,995,759 (GRCm39) V922A possibly damaging Het
Or12d17 T A 17: 37,777,994 (GRCm39) M299K probably benign Het
Or5b105 T A 19: 13,080,417 (GRCm39) I84F probably benign Het
Or5d45 A C 2: 88,153,425 (GRCm39) I208S probably benign Het
Pccb C A 9: 100,909,137 (GRCm39) C144F probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Prdm1 A G 10: 44,334,478 (GRCm39) V16A probably benign Het
Prr5 A C 15: 84,649,933 (GRCm39) Y219S probably damaging Het
Psme4 A G 11: 30,824,245 (GRCm39) D1743G probably benign Het
Rad21l G T 2: 151,497,045 (GRCm39) D356E probably benign Het
Rars1 A G 11: 35,710,793 (GRCm39) I322T probably damaging Het
Retreg2 C A 1: 75,123,185 (GRCm39) P319Q possibly damaging Het
Robo2 T C 16: 73,770,059 (GRCm39) Y559C probably damaging Het
Ror1 T C 4: 100,298,564 (GRCm39) Y646H probably damaging Het
Rrp15 A G 1: 186,481,373 (GRCm39) S45P probably benign Het
Sacs G C 14: 61,429,652 (GRCm39) K570N probably benign Het
Serpinb8 C T 1: 107,534,723 (GRCm39) Q265* probably null Het
Sgo2b T C 8: 64,380,318 (GRCm39) E838G probably damaging Het
Slc2a12 G A 10: 22,540,568 (GRCm39) R141K probably damaging Het
Strc G T 2: 121,208,219 (GRCm39) T384N probably benign Het
Tcaf2 T C 6: 42,606,033 (GRCm39) S547G possibly damaging Het
Tekt5 T C 16: 10,200,792 (GRCm39) N243S possibly damaging Het
Tgm3 A G 2: 129,883,819 (GRCm39) I492M probably benign Het
Tgm7 G A 2: 120,934,421 (GRCm39) T157I probably benign Het
Trnp1 C A 4: 133,225,350 (GRCm39) R140L possibly damaging Het
Ttn A G 2: 76,609,777 (GRCm39) V15797A probably damaging Het
Ugp2 A T 11: 21,283,762 (GRCm39) S102T probably benign Het
Vav2 A T 2: 27,172,299 (GRCm39) probably null Het
Vmn1r202 T A 13: 22,686,241 (GRCm39) I59F probably damaging Het
Yju2b T C 8: 84,988,411 (GRCm39) E72G probably damaging Het
Zfp109 T C 7: 23,928,570 (GRCm39) T288A probably benign Het
Zscan12 T A 13: 21,553,374 (GRCm39) H399Q probably damaging Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60,908,854 (GRCm39) missense probably benign 0.23
IGL00500:Dapk1 APN 13 60,908,618 (GRCm39) missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60,909,062 (GRCm39) missense probably benign 0.00
IGL00903:Dapk1 APN 13 60,909,211 (GRCm39) missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60,908,612 (GRCm39) missense probably benign
IGL01535:Dapk1 APN 13 60,878,845 (GRCm39) splice site probably benign
IGL01755:Dapk1 APN 13 60,908,990 (GRCm39) missense possibly damaging 0.63
IGL01755:Dapk1 APN 13 60,908,989 (GRCm39) missense probably damaging 0.97
IGL01862:Dapk1 APN 13 60,874,424 (GRCm39) missense probably benign 0.39
IGL01985:Dapk1 APN 13 60,884,074 (GRCm39) missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60,878,696 (GRCm39) missense probably benign
IGL02376:Dapk1 APN 13 60,844,208 (GRCm39) missense probably benign 0.00
IGL02449:Dapk1 APN 13 60,867,584 (GRCm39) splice site probably benign
IGL02490:Dapk1 APN 13 60,897,148 (GRCm39) missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60,909,621 (GRCm39) nonsense probably null
IGL02516:Dapk1 APN 13 60,844,161 (GRCm39) missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60,899,031 (GRCm39) missense probably benign
IGL02604:Dapk1 APN 13 60,896,134 (GRCm39) missense probably benign
IGL03035:Dapk1 APN 13 60,864,587 (GRCm39) missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60,909,126 (GRCm39) missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60,865,963 (GRCm39) splice site probably benign
R0116:Dapk1 UTSW 13 60,908,914 (GRCm39) missense probably benign
R0165:Dapk1 UTSW 13 60,909,407 (GRCm39) missense probably benign 0.39
R0357:Dapk1 UTSW 13 60,877,372 (GRCm39) nonsense probably null
R0446:Dapk1 UTSW 13 60,873,101 (GRCm39) splice site probably null
R0502:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0503:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0597:Dapk1 UTSW 13 60,909,198 (GRCm39) missense probably benign 0.40
R0614:Dapk1 UTSW 13 60,865,946 (GRCm39) missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60,905,262 (GRCm39) missense probably benign 0.14
R1023:Dapk1 UTSW 13 60,878,799 (GRCm39) missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60,869,679 (GRCm39) critical splice donor site probably null
R1101:Dapk1 UTSW 13 60,864,599 (GRCm39) missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60,901,957 (GRCm39) missense probably benign 0.28
R1630:Dapk1 UTSW 13 60,877,345 (GRCm39) missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60,866,278 (GRCm39) critical splice donor site probably null
R1799:Dapk1 UTSW 13 60,867,468 (GRCm39) missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60,869,671 (GRCm39) missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60,899,022 (GRCm39) missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60,909,481 (GRCm39) missense possibly damaging 0.80
R2131:Dapk1 UTSW 13 60,877,345 (GRCm39) missense possibly damaging 0.91
R2154:Dapk1 UTSW 13 60,877,317 (GRCm39) missense probably benign 0.36
R2288:Dapk1 UTSW 13 60,909,563 (GRCm39) missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60,905,167 (GRCm39) missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60,878,745 (GRCm39) missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60,900,030 (GRCm39) missense probably benign 0.34
R2909:Dapk1 UTSW 13 60,864,631 (GRCm39) critical splice donor site probably null
R2926:Dapk1 UTSW 13 60,867,564 (GRCm39) missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60,896,014 (GRCm39) missense probably benign 0.09
R3810:Dapk1 UTSW 13 60,908,503 (GRCm39) missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4375:Dapk1 UTSW 13 60,909,403 (GRCm39) missense probably benign
R4377:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4490:Dapk1 UTSW 13 60,865,942 (GRCm39) missense probably benign 0.26
R4576:Dapk1 UTSW 13 60,869,636 (GRCm39) missense probably benign 0.13
R4599:Dapk1 UTSW 13 60,865,861 (GRCm39) missense probably benign 0.22
R4682:Dapk1 UTSW 13 60,898,961 (GRCm39) missense probably benign 0.41
R4717:Dapk1 UTSW 13 60,874,476 (GRCm39) critical splice donor site probably null
R4775:Dapk1 UTSW 13 60,897,156 (GRCm39) missense probably benign 0.02
R4790:Dapk1 UTSW 13 60,870,919 (GRCm39) frame shift probably null
R4897:Dapk1 UTSW 13 60,909,600 (GRCm39) missense probably benign 0.01
R4931:Dapk1 UTSW 13 60,908,774 (GRCm39) missense probably benign 0.04
R5113:Dapk1 UTSW 13 60,869,592 (GRCm39) missense probably benign 0.01
R5503:Dapk1 UTSW 13 60,873,126 (GRCm39) missense probably benign 0.15
R5948:Dapk1 UTSW 13 60,877,209 (GRCm39) missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60,909,476 (GRCm39) missense probably benign 0.00
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60,909,580 (GRCm39) missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60,909,140 (GRCm39) missense probably benign 0.01
R6331:Dapk1 UTSW 13 60,877,256 (GRCm39) nonsense probably null
R6553:Dapk1 UTSW 13 60,908,975 (GRCm39) missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60,909,161 (GRCm39) missense probably benign 0.03
R6602:Dapk1 UTSW 13 60,897,018 (GRCm39) missense probably benign 0.20
R6640:Dapk1 UTSW 13 60,864,628 (GRCm39) missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60,908,708 (GRCm39) missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60,873,154 (GRCm39) missense probably benign 0.22
R6799:Dapk1 UTSW 13 60,900,049 (GRCm39) missense probably benign
R6809:Dapk1 UTSW 13 60,899,103 (GRCm39) missense probably benign 0.00
R6915:Dapk1 UTSW 13 60,844,256 (GRCm39) missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60,884,138 (GRCm39) missense probably benign 0.11
R6979:Dapk1 UTSW 13 60,896,095 (GRCm39) missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60,844,209 (GRCm39) missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60,909,599 (GRCm39) missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60,902,024 (GRCm39) missense probably benign 0.02
R7203:Dapk1 UTSW 13 60,844,149 (GRCm39) missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60,867,455 (GRCm39) missense probably benign 0.00
R7448:Dapk1 UTSW 13 60,898,990 (GRCm39) missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60,905,311 (GRCm39) missense probably benign 0.18
R7532:Dapk1 UTSW 13 60,878,700 (GRCm39) missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60,908,987 (GRCm39) missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60,909,365 (GRCm39) missense probably damaging 1.00
R7753:Dapk1 UTSW 13 60,899,007 (GRCm39) missense possibly damaging 0.58
R7804:Dapk1 UTSW 13 60,873,153 (GRCm39) missense probably benign 0.41
R7973:Dapk1 UTSW 13 60,909,377 (GRCm39) missense probably damaging 1.00
R8103:Dapk1 UTSW 13 60,897,009 (GRCm39) missense probably damaging 0.98
R8121:Dapk1 UTSW 13 60,909,212 (GRCm39) missense probably damaging 0.99
R8245:Dapk1 UTSW 13 60,878,710 (GRCm39) missense probably benign
R8401:Dapk1 UTSW 13 60,870,904 (GRCm39) missense probably benign 0.01
R8419:Dapk1 UTSW 13 60,887,911 (GRCm39) missense probably benign 0.00
R8926:Dapk1 UTSW 13 60,908,734 (GRCm39) missense probably damaging 0.98
R9063:Dapk1 UTSW 13 60,866,264 (GRCm39) missense probably benign 0.06
R9131:Dapk1 UTSW 13 60,909,208 (GRCm39) missense probably damaging 1.00
R9176:Dapk1 UTSW 13 60,866,262 (GRCm39) missense probably damaging 1.00
R9301:Dapk1 UTSW 13 60,866,125 (GRCm39) missense possibly damaging 0.92
R9407:Dapk1 UTSW 13 60,898,991 (GRCm39) nonsense probably null
R9491:Dapk1 UTSW 13 60,877,369 (GRCm39) missense probably benign 0.44
R9510:Dapk1 UTSW 13 60,910,203 (GRCm39) missense unknown
R9624:Dapk1 UTSW 13 60,895,937 (GRCm39) missense probably benign 0.31
R9726:Dapk1 UTSW 13 60,898,948 (GRCm39) missense probably benign 0.25
R9794:Dapk1 UTSW 13 60,909,082 (GRCm39) missense probably damaging 0.98
Z1176:Dapk1 UTSW 13 60,908,618 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACATGCTACAGCCTTGTGC -3'
(R):5'- CTGTGAATTAGCGTACAGGGG -3'

Sequencing Primer
(F):5'- TACAGCCTTGTGCCCATGGAG -3'
(R):5'- GGGTTAAGTGTGCACCCTTCC -3'
Posted On 2019-12-03