Incidental Mutation 'R7822:Dapk1'
ID601955
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Namedeath associated protein kinase 1
SynonymsDAP-Kinase, 2310039H24Rik, D13Ucla1, 2810425C21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7822 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location60601947-60763191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 60725901 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 406 (D406A)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
Predicted Effect probably benign
Transcript: ENSMUST00000044083
AA Change: D406A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: D406A

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077453
AA Change: D406A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: D406A

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224789
Predicted Effect probably benign
Transcript: ENSMUST00000226059
AA Change: D406A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,880,713 S551L possibly damaging Het
Arhgap8 A C 15: 84,765,732 Y219S probably damaging Het
Ash1l T C 3: 89,007,264 S1734P probably benign Het
Btnl2 T A 17: 34,363,314 S285T possibly damaging Het
Cadm4 A G 7: 24,503,545 D364G possibly damaging Het
Card6 T A 15: 5,098,865 K1016N possibly damaging Het
Ccdc130 T C 8: 84,261,782 E72G probably damaging Het
Cdh2 G T 18: 16,624,284 N692K probably benign Het
Cep76 G T 18: 67,641,149 S9* probably null Het
Cklf T C 8: 104,251,097 probably null Het
Ctsa T C 2: 164,839,232 *475R probably null Het
Ddx4 A T 13: 112,612,113 V443D probably damaging Het
Dph5 C T 3: 115,899,750 Q106* probably null Het
Drg2 C T 11: 60,462,200 R220* probably null Het
Efcab8 A T 2: 153,810,912 Q509L unknown Het
Efs C T 14: 54,917,450 S444N probably benign Het
Evl T C 12: 108,648,464 V58A probably damaging Het
Fam71b A G 11: 46,404,903 N34S Het
Gbe1 G A 16: 70,433,612 R166H probably damaging Het
Gcc1 T C 6: 28,418,786 E516G probably damaging Het
Ghr T C 15: 3,457,957 T15A probably benign Het
Gnb4 G A 3: 32,596,331 T50M probably damaging Het
Grik3 T C 4: 125,656,397 probably null Het
Gstk1 T C 6: 42,247,752 Y135H probably benign Het
Gucy2c T A 6: 136,708,406 I846F probably damaging Het
Itga7 A G 10: 128,942,966 T321A probably benign Het
Jakmip1 A T 5: 37,175,180 N1068I probably damaging Het
Krt36 A G 11: 100,104,140 I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mast2 A G 4: 116,312,873 L741P probably damaging Het
Mctp2 T C 7: 72,127,187 N720S possibly damaging Het
Mmp9 A T 2: 164,949,036 K115* probably null Het
Mtf2 C T 5: 108,080,877 R20* probably null Het
Mycbp2 T G 14: 103,139,415 Q3810P probably benign Het
Myom2 A T 8: 15,108,454 H802L probably benign Het
Naa25 A G 5: 121,407,213 N27D probably damaging Het
Necab2 T C 8: 119,454,364 F126L probably damaging Het
Nisch C G 14: 31,174,651 probably benign Het
Nsd2 T A 5: 33,843,594 S152T probably damaging Het
Ntsr1 T C 2: 180,538,690 L263P probably damaging Het
Nup210 A G 6: 91,018,777 V922A possibly damaging Het
Olfr109 T A 17: 37,467,103 M299K probably benign Het
Olfr1175-ps A C 2: 88,323,081 I208S probably benign Het
Olfr1458 T A 19: 13,103,053 I84F probably benign Het
Pccb C A 9: 101,027,084 C144F probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prdm1 A G 10: 44,458,482 V16A probably benign Het
Psme4 A G 11: 30,874,245 D1743G probably benign Het
Rad21l G T 2: 151,655,125 D356E probably benign Het
Rars A G 11: 35,819,966 I322T probably damaging Het
Retreg2 C A 1: 75,146,541 P319Q possibly damaging Het
Robo2 T C 16: 73,973,171 Y559C probably damaging Het
Ror1 T C 4: 100,441,367 Y646H probably damaging Het
Rrp15 A G 1: 186,749,176 S45P probably benign Het
Sacs G C 14: 61,192,203 K570N probably benign Het
Serpinb8 C T 1: 107,606,993 Q265* probably null Het
Sgo2b T C 8: 63,927,284 E838G probably damaging Het
Slc2a12 G A 10: 22,664,669 R141K probably damaging Het
Strc G T 2: 121,377,738 T384N probably benign Het
Tcaf2 T C 6: 42,629,099 S547G possibly damaging Het
Tekt5 T C 16: 10,382,928 N243S possibly damaging Het
Tgm3 A G 2: 130,041,899 I492M probably benign Het
Tgm7 G A 2: 121,103,940 T157I probably benign Het
Trnp1 C A 4: 133,498,039 R140L possibly damaging Het
Ttn A G 2: 76,779,433 V15797A probably damaging Het
Ugp2 A T 11: 21,333,762 S102T probably benign Het
Vav2 A T 2: 27,282,287 probably null Het
Vmn1r202 T A 13: 22,502,071 I59F probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zscan12 T A 13: 21,369,204 H399Q probably damaging Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60761040 missense probably benign 0.23
IGL00500:Dapk1 APN 13 60760804 missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60761248 missense probably benign 0.00
IGL00903:Dapk1 APN 13 60761397 missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60760798 missense probably benign
IGL01535:Dapk1 APN 13 60731031 splice site probably benign
IGL01755:Dapk1 APN 13 60761175 missense probably damaging 0.97
IGL01755:Dapk1 APN 13 60761176 missense possibly damaging 0.63
IGL01862:Dapk1 APN 13 60726610 missense probably benign 0.39
IGL01985:Dapk1 APN 13 60736260 missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60730882 missense probably benign
IGL02376:Dapk1 APN 13 60696394 missense probably benign 0.00
IGL02449:Dapk1 APN 13 60719770 splice site probably benign
IGL02490:Dapk1 APN 13 60749334 missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60761807 nonsense probably null
IGL02516:Dapk1 APN 13 60696347 missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60751217 missense probably benign
IGL02604:Dapk1 APN 13 60748320 missense probably benign
IGL03035:Dapk1 APN 13 60716773 missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60761312 missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60718149 splice site probably benign
R0116:Dapk1 UTSW 13 60761100 missense probably benign
R0165:Dapk1 UTSW 13 60761593 missense probably benign 0.39
R0357:Dapk1 UTSW 13 60729558 nonsense probably null
R0446:Dapk1 UTSW 13 60725287 splice site probably null
R0502:Dapk1 UTSW 13 60730848 synonymous probably null
R0503:Dapk1 UTSW 13 60730848 synonymous probably null
R0597:Dapk1 UTSW 13 60761384 missense probably benign 0.40
R0614:Dapk1 UTSW 13 60718132 missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60757448 missense probably benign 0.14
R1023:Dapk1 UTSW 13 60730985 missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60721865 critical splice donor site probably null
R1101:Dapk1 UTSW 13 60716785 missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60754143 missense probably benign 0.28
R1630:Dapk1 UTSW 13 60729531 missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60718464 critical splice donor site probably null
R1799:Dapk1 UTSW 13 60719654 missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60721857 missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60751208 missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60729531 missense possibly damaging 0.91
R2131:Dapk1 UTSW 13 60761667 missense possibly damaging 0.80
R2154:Dapk1 UTSW 13 60729503 missense probably benign 0.36
R2288:Dapk1 UTSW 13 60761749 missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60757353 missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60730931 missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60752216 missense probably benign 0.34
R2909:Dapk1 UTSW 13 60716817 critical splice donor site probably null
R2926:Dapk1 UTSW 13 60719750 missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60748200 missense probably benign 0.09
R3810:Dapk1 UTSW 13 60760689 missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4375:Dapk1 UTSW 13 60761589 missense probably benign
R4377:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4490:Dapk1 UTSW 13 60718128 missense probably benign 0.26
R4576:Dapk1 UTSW 13 60721822 missense probably benign 0.13
R4599:Dapk1 UTSW 13 60718047 missense probably benign 0.22
R4682:Dapk1 UTSW 13 60751147 missense probably benign 0.41
R4717:Dapk1 UTSW 13 60726662 critical splice donor site probably null
R4775:Dapk1 UTSW 13 60749342 missense probably benign 0.02
R4790:Dapk1 UTSW 13 60723105 frame shift probably null
R4897:Dapk1 UTSW 13 60761786 missense probably benign 0.01
R4931:Dapk1 UTSW 13 60760960 missense probably benign 0.04
R5113:Dapk1 UTSW 13 60721778 missense probably benign 0.01
R5503:Dapk1 UTSW 13 60725312 missense probably benign 0.15
R5948:Dapk1 UTSW 13 60729395 missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60761662 missense probably benign 0.00
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60761766 missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60761326 missense probably benign 0.01
R6331:Dapk1 UTSW 13 60729442 nonsense probably null
R6553:Dapk1 UTSW 13 60761161 missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60761347 missense probably benign 0.03
R6602:Dapk1 UTSW 13 60749204 missense probably benign 0.20
R6640:Dapk1 UTSW 13 60716814 missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60760894 missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60725340 missense probably benign 0.22
R6799:Dapk1 UTSW 13 60752235 missense probably benign
R6809:Dapk1 UTSW 13 60751289 missense probably benign 0.00
R6915:Dapk1 UTSW 13 60696442 missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60736324 missense probably benign 0.11
R6979:Dapk1 UTSW 13 60748281 missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60696395 missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60761785 missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60754210 missense probably benign 0.02
R7203:Dapk1 UTSW 13 60696335 missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60719641 missense probably benign 0.00
R7448:Dapk1 UTSW 13 60751176 missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60757497 missense probably benign 0.18
R7532:Dapk1 UTSW 13 60730886 missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60761173 missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60761551 missense probably damaging 1.00
R7753:Dapk1 UTSW 13 60751193 missense possibly damaging 0.58
R7804:Dapk1 UTSW 13 60725339 missense probably benign 0.41
Z1176:Dapk1 UTSW 13 60760804 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACATGCTACAGCCTTGTGC -3'
(R):5'- CTGTGAATTAGCGTACAGGGG -3'

Sequencing Primer
(F):5'- TACAGCCTTGTGCCCATGGAG -3'
(R):5'- GGGTTAAGTGTGCACCCTTCC -3'
Posted On2019-12-03