Incidental Mutation 'R7822:Efs'
ID601958
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Nameembryonal Fyn-associated substrate
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7822 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54916535-54926126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54917450 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 444 (S444N)
Ref Sequence ENSEMBL: ENSMUSP00000022813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000050772] [ENSMUST00000227037] [ENSMUST00000227587] [ENSMUST00000227880] [ENSMUST00000228119] [ENSMUST00000228495] [ENSMUST00000228588] [ENSMUST00000231305]
Predicted Effect probably benign
Transcript: ENSMUST00000022813
AA Change: S444N

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: S444N

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050772
SMART Domains Protein: ENSMUSP00000049676
Gene: ENSMUSG00000022199

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 370 1.8e-17 PFAM
Pfam:MFS_1 211 394 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226467
Predicted Effect probably benign
Transcript: ENSMUST00000227037
AA Change: S351N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227587
Predicted Effect probably benign
Transcript: ENSMUST00000227880
Predicted Effect probably benign
Transcript: ENSMUST00000228119
Predicted Effect probably benign
Transcript: ENSMUST00000228495
Predicted Effect probably benign
Transcript: ENSMUST00000228588
Predicted Effect probably benign
Transcript: ENSMUST00000231305
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,880,713 S551L possibly damaging Het
Arhgap8 A C 15: 84,765,732 Y219S probably damaging Het
Ash1l T C 3: 89,007,264 S1734P probably benign Het
Btnl2 T A 17: 34,363,314 S285T possibly damaging Het
Cadm4 A G 7: 24,503,545 D364G possibly damaging Het
Card6 T A 15: 5,098,865 K1016N possibly damaging Het
Ccdc130 T C 8: 84,261,782 E72G probably damaging Het
Cdh2 G T 18: 16,624,284 N692K probably benign Het
Cep76 G T 18: 67,641,149 S9* probably null Het
Cklf T C 8: 104,251,097 probably null Het
Ctsa T C 2: 164,839,232 *475R probably null Het
Dapk1 A C 13: 60,725,901 D406A probably benign Het
Ddx4 A T 13: 112,612,113 V443D probably damaging Het
Dph5 C T 3: 115,899,750 Q106* probably null Het
Drg2 C T 11: 60,462,200 R220* probably null Het
Efcab8 A T 2: 153,810,912 Q509L unknown Het
Evl T C 12: 108,648,464 V58A probably damaging Het
Fam71b A G 11: 46,404,903 N34S Het
Gbe1 G A 16: 70,433,612 R166H probably damaging Het
Gcc1 T C 6: 28,418,786 E516G probably damaging Het
Ghr T C 15: 3,457,957 T15A probably benign Het
Gnb4 G A 3: 32,596,331 T50M probably damaging Het
Grik3 T C 4: 125,656,397 probably null Het
Gstk1 T C 6: 42,247,752 Y135H probably benign Het
Gucy2c T A 6: 136,708,406 I846F probably damaging Het
Itga7 A G 10: 128,942,966 T321A probably benign Het
Jakmip1 A T 5: 37,175,180 N1068I probably damaging Het
Krt36 A G 11: 100,104,140 I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mast2 A G 4: 116,312,873 L741P probably damaging Het
Mctp2 T C 7: 72,127,187 N720S possibly damaging Het
Mmp9 A T 2: 164,949,036 K115* probably null Het
Mtf2 C T 5: 108,080,877 R20* probably null Het
Mycbp2 T G 14: 103,139,415 Q3810P probably benign Het
Myom2 A T 8: 15,108,454 H802L probably benign Het
Naa25 A G 5: 121,407,213 N27D probably damaging Het
Necab2 T C 8: 119,454,364 F126L probably damaging Het
Nisch C G 14: 31,174,651 probably benign Het
Nsd2 T A 5: 33,843,594 S152T probably damaging Het
Ntsr1 T C 2: 180,538,690 L263P probably damaging Het
Nup210 A G 6: 91,018,777 V922A possibly damaging Het
Olfr109 T A 17: 37,467,103 M299K probably benign Het
Olfr1175-ps A C 2: 88,323,081 I208S probably benign Het
Olfr1458 T A 19: 13,103,053 I84F probably benign Het
Pccb C A 9: 101,027,084 C144F probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Prdm1 A G 10: 44,458,482 V16A probably benign Het
Psme4 A G 11: 30,874,245 D1743G probably benign Het
Rad21l G T 2: 151,655,125 D356E probably benign Het
Rars A G 11: 35,819,966 I322T probably damaging Het
Retreg2 C A 1: 75,146,541 P319Q possibly damaging Het
Robo2 T C 16: 73,973,171 Y559C probably damaging Het
Ror1 T C 4: 100,441,367 Y646H probably damaging Het
Rrp15 A G 1: 186,749,176 S45P probably benign Het
Sacs G C 14: 61,192,203 K570N probably benign Het
Serpinb8 C T 1: 107,606,993 Q265* probably null Het
Sgo2b T C 8: 63,927,284 E838G probably damaging Het
Slc2a12 G A 10: 22,664,669 R141K probably damaging Het
Strc G T 2: 121,377,738 T384N probably benign Het
Tcaf2 T C 6: 42,629,099 S547G possibly damaging Het
Tekt5 T C 16: 10,382,928 N243S possibly damaging Het
Tgm3 A G 2: 130,041,899 I492M probably benign Het
Tgm7 G A 2: 121,103,940 T157I probably benign Het
Trnp1 C A 4: 133,498,039 R140L possibly damaging Het
Ttn A G 2: 76,779,433 V15797A probably damaging Het
Ugp2 A T 11: 21,333,762 S102T probably benign Het
Vav2 A T 2: 27,282,287 probably null Het
Vmn1r202 T A 13: 22,502,071 I59F probably damaging Het
Zfp109 T C 7: 24,229,145 T288A probably benign Het
Zscan12 T A 13: 21,369,204 H399Q probably damaging Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 54921042 missense probably damaging 1.00
IGL02720:Efs APN 14 54919715 missense probably damaging 1.00
IGL02752:Efs APN 14 54917423 missense probably damaging 0.96
R0129:Efs UTSW 14 54917223 missense probably damaging 1.00
R1522:Efs UTSW 14 54919715 missense probably damaging 1.00
R1927:Efs UTSW 14 54917163 missense possibly damaging 0.89
R2327:Efs UTSW 14 54917504 missense probably benign 0.01
R3431:Efs UTSW 14 54920224 missense probably damaging 1.00
R3432:Efs UTSW 14 54920224 missense probably damaging 1.00
R3615:Efs UTSW 14 54920095 missense probably damaging 1.00
R3616:Efs UTSW 14 54920095 missense probably damaging 1.00
R3756:Efs UTSW 14 54920422 splice site probably benign
R3945:Efs UTSW 14 54920651 splice site probably benign
R4448:Efs UTSW 14 54920192 missense probably damaging 1.00
R4717:Efs UTSW 14 54920344 missense probably damaging 0.99
R4819:Efs UTSW 14 54917153 missense probably damaging 0.98
R5656:Efs UTSW 14 54917127 missense probably damaging 1.00
R5946:Efs UTSW 14 54919494 splice site probably null
R6054:Efs UTSW 14 54921157 missense probably damaging 1.00
R7457:Efs UTSW 14 54919994 missense probably benign
R7970:Efs UTSW 14 54920503 critical splice donor site probably null
R8166:Efs UTSW 14 54920620 missense probably damaging 1.00
R8347:Efs UTSW 14 54919784 missense probably benign 0.28
X0028:Efs UTSW 14 54920621 nonsense probably null
Z1176:Efs UTSW 14 54920336 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGTTTGGGCCAGCATTG -3'
(R):5'- TCTTTGATGCTGAGAAAAGGGG -3'

Sequencing Primer
(F):5'- AGCATTGTGCCTGCAGC -3'
(R):5'- AGGGATTGCATTCAATAAAGAAAAAC -3'
Posted On2019-12-03