Incidental Mutation 'R7822:Efs'
ID 601958
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Name embryonal Fyn-associated substrate
Synonyms
MMRRC Submission 045876-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R7822 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 55153992-55163583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55154907 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 444 (S444N)
Ref Sequence ENSEMBL: ENSMUSP00000022813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000050772] [ENSMUST00000227037] [ENSMUST00000227587] [ENSMUST00000227880] [ENSMUST00000228119] [ENSMUST00000228495] [ENSMUST00000228588] [ENSMUST00000231305]
AlphaFold Q64355
Predicted Effect probably benign
Transcript: ENSMUST00000022813
AA Change: S444N

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: S444N

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050772
SMART Domains Protein: ENSMUSP00000049676
Gene: ENSMUSG00000022199

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 370 1.8e-17 PFAM
Pfam:MFS_1 211 394 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226467
Predicted Effect probably benign
Transcript: ENSMUST00000227037
AA Change: S351N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227587
Predicted Effect probably benign
Transcript: ENSMUST00000227880
Predicted Effect probably benign
Transcript: ENSMUST00000228119
Predicted Effect probably benign
Transcript: ENSMUST00000228495
Predicted Effect probably benign
Transcript: ENSMUST00000228588
Predicted Effect probably benign
Transcript: ENSMUST00000231305
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,885,524 (GRCm39) S551L possibly damaging Het
Ash1l T C 3: 88,914,571 (GRCm39) S1734P probably benign Het
Btnl2 T A 17: 34,582,288 (GRCm39) S285T possibly damaging Het
Cadm4 A G 7: 24,202,970 (GRCm39) D364G possibly damaging Het
Card6 T A 15: 5,128,347 (GRCm39) K1016N possibly damaging Het
Cdh2 G T 18: 16,757,341 (GRCm39) N692K probably benign Het
Cep76 G T 18: 67,774,219 (GRCm39) S9* probably null Het
Cklf T C 8: 104,977,729 (GRCm39) probably null Het
Ctsa T C 2: 164,681,152 (GRCm39) *475R probably null Het
Dapk1 A C 13: 60,873,715 (GRCm39) D406A probably benign Het
Ddx4 A T 13: 112,748,647 (GRCm39) V443D probably damaging Het
Dph5 C T 3: 115,693,399 (GRCm39) Q106* probably null Het
Drg2 C T 11: 60,353,026 (GRCm39) R220* probably null Het
Efcab8 A T 2: 153,652,832 (GRCm39) Q509L unknown Het
Evl T C 12: 108,614,723 (GRCm39) V58A probably damaging Het
Garin3 A G 11: 46,295,730 (GRCm39) N34S Het
Gbe1 G A 16: 70,230,500 (GRCm39) R166H probably damaging Het
Gcc1 T C 6: 28,418,785 (GRCm39) E516G probably damaging Het
Ghr T C 15: 3,487,439 (GRCm39) T15A probably benign Het
Gnb4 G A 3: 32,650,480 (GRCm39) T50M probably damaging Het
Grik3 T C 4: 125,550,190 (GRCm39) probably null Het
Gstk1 T C 6: 42,224,686 (GRCm39) Y135H probably benign Het
Gucy2c T A 6: 136,685,404 (GRCm39) I846F probably damaging Het
Itga7 A G 10: 128,778,835 (GRCm39) T321A probably benign Het
Jakmip1 A T 5: 37,332,524 (GRCm39) N1068I probably damaging Het
Krt36 A G 11: 99,994,966 (GRCm39) I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Mast2 A G 4: 116,170,070 (GRCm39) L741P probably damaging Het
Mctp2 T C 7: 71,776,935 (GRCm39) N720S possibly damaging Het
Mmp9 A T 2: 164,790,956 (GRCm39) K115* probably null Het
Mtf2 C T 5: 108,228,743 (GRCm39) R20* probably null Het
Mycbp2 T G 14: 103,376,851 (GRCm39) Q3810P probably benign Het
Myom2 A T 8: 15,158,454 (GRCm39) H802L probably benign Het
Naa25 A G 5: 121,545,276 (GRCm39) N27D probably damaging Het
Necab2 T C 8: 120,181,103 (GRCm39) F126L probably damaging Het
Nisch C G 14: 30,896,608 (GRCm39) probably benign Het
Nsd2 T A 5: 34,000,938 (GRCm39) S152T probably damaging Het
Ntsr1 T C 2: 180,180,483 (GRCm39) L263P probably damaging Het
Nup210 A G 6: 90,995,759 (GRCm39) V922A possibly damaging Het
Or12d17 T A 17: 37,777,994 (GRCm39) M299K probably benign Het
Or5b105 T A 19: 13,080,417 (GRCm39) I84F probably benign Het
Or5d45 A C 2: 88,153,425 (GRCm39) I208S probably benign Het
Pccb C A 9: 100,909,137 (GRCm39) C144F probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Prdm1 A G 10: 44,334,478 (GRCm39) V16A probably benign Het
Prr5 A C 15: 84,649,933 (GRCm39) Y219S probably damaging Het
Psme4 A G 11: 30,824,245 (GRCm39) D1743G probably benign Het
Rad21l G T 2: 151,497,045 (GRCm39) D356E probably benign Het
Rars1 A G 11: 35,710,793 (GRCm39) I322T probably damaging Het
Retreg2 C A 1: 75,123,185 (GRCm39) P319Q possibly damaging Het
Robo2 T C 16: 73,770,059 (GRCm39) Y559C probably damaging Het
Ror1 T C 4: 100,298,564 (GRCm39) Y646H probably damaging Het
Rrp15 A G 1: 186,481,373 (GRCm39) S45P probably benign Het
Sacs G C 14: 61,429,652 (GRCm39) K570N probably benign Het
Serpinb8 C T 1: 107,534,723 (GRCm39) Q265* probably null Het
Sgo2b T C 8: 64,380,318 (GRCm39) E838G probably damaging Het
Slc2a12 G A 10: 22,540,568 (GRCm39) R141K probably damaging Het
Strc G T 2: 121,208,219 (GRCm39) T384N probably benign Het
Tcaf2 T C 6: 42,606,033 (GRCm39) S547G possibly damaging Het
Tekt5 T C 16: 10,200,792 (GRCm39) N243S possibly damaging Het
Tgm3 A G 2: 129,883,819 (GRCm39) I492M probably benign Het
Tgm7 G A 2: 120,934,421 (GRCm39) T157I probably benign Het
Trnp1 C A 4: 133,225,350 (GRCm39) R140L possibly damaging Het
Ttn A G 2: 76,609,777 (GRCm39) V15797A probably damaging Het
Ugp2 A T 11: 21,283,762 (GRCm39) S102T probably benign Het
Vav2 A T 2: 27,172,299 (GRCm39) probably null Het
Vmn1r202 T A 13: 22,686,241 (GRCm39) I59F probably damaging Het
Yju2b T C 8: 84,988,411 (GRCm39) E72G probably damaging Het
Zfp109 T C 7: 23,928,570 (GRCm39) T288A probably benign Het
Zscan12 T A 13: 21,553,374 (GRCm39) H399Q probably damaging Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 55,158,499 (GRCm39) missense probably damaging 1.00
IGL02720:Efs APN 14 55,157,172 (GRCm39) missense probably damaging 1.00
IGL02752:Efs APN 14 55,154,880 (GRCm39) missense probably damaging 0.96
R0129:Efs UTSW 14 55,154,680 (GRCm39) missense probably damaging 1.00
R1522:Efs UTSW 14 55,157,172 (GRCm39) missense probably damaging 1.00
R1927:Efs UTSW 14 55,154,620 (GRCm39) missense possibly damaging 0.89
R2327:Efs UTSW 14 55,154,961 (GRCm39) missense probably benign 0.01
R3431:Efs UTSW 14 55,157,681 (GRCm39) missense probably damaging 1.00
R3432:Efs UTSW 14 55,157,681 (GRCm39) missense probably damaging 1.00
R3615:Efs UTSW 14 55,157,552 (GRCm39) missense probably damaging 1.00
R3616:Efs UTSW 14 55,157,552 (GRCm39) missense probably damaging 1.00
R3756:Efs UTSW 14 55,157,879 (GRCm39) splice site probably benign
R3945:Efs UTSW 14 55,158,108 (GRCm39) splice site probably benign
R4448:Efs UTSW 14 55,157,649 (GRCm39) missense probably damaging 1.00
R4717:Efs UTSW 14 55,157,801 (GRCm39) missense probably damaging 0.99
R4819:Efs UTSW 14 55,154,610 (GRCm39) missense probably damaging 0.98
R5656:Efs UTSW 14 55,154,584 (GRCm39) missense probably damaging 1.00
R5946:Efs UTSW 14 55,156,951 (GRCm39) splice site probably null
R6054:Efs UTSW 14 55,158,614 (GRCm39) missense probably damaging 1.00
R7457:Efs UTSW 14 55,157,451 (GRCm39) missense probably benign
R7970:Efs UTSW 14 55,157,960 (GRCm39) critical splice donor site probably null
R8166:Efs UTSW 14 55,158,077 (GRCm39) missense probably damaging 1.00
R8347:Efs UTSW 14 55,157,241 (GRCm39) missense probably benign 0.28
R8896:Efs UTSW 14 55,157,756 (GRCm39) missense possibly damaging 0.80
R9438:Efs UTSW 14 55,156,868 (GRCm39) missense
R9703:Efs UTSW 14 55,156,871 (GRCm39) missense possibly damaging 0.88
X0028:Efs UTSW 14 55,158,078 (GRCm39) nonsense probably null
Z1176:Efs UTSW 14 55,157,793 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGTTTGGGCCAGCATTG -3'
(R):5'- TCTTTGATGCTGAGAAAAGGGG -3'

Sequencing Primer
(F):5'- AGCATTGTGCCTGCAGC -3'
(R):5'- AGGGATTGCATTCAATAAAGAAAAAC -3'
Posted On 2019-12-03