Incidental Mutation 'R7822:Mycbp2'
ID 601960
Institutional Source Beutler Lab
Gene Symbol Mycbp2
Ensembl Gene ENSMUSG00000033004
Gene Name MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms Phr1, Pam, C130061D10Rik
MMRRC Submission 045876-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7822 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 103350847-103584250 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 103376851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 3810 (Q3810P)
Ref Sequence ENSEMBL: ENSMUSP00000124601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159855] [ENSMUST00000160758]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000159855
AA Change: Q3920P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124710
Gene: ENSMUSG00000033004
AA Change: Q3920P

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 47 55 N/A INTRINSIC
low complexity region 100 127 N/A INTRINSIC
low complexity region 178 191 N/A INTRINSIC
Pfam:RCC1_2 683 712 1.4e-10 PFAM
low complexity region 737 750 N/A INTRINSIC
low complexity region 793 815 N/A INTRINSIC
Pfam:RCC1_2 942 971 5.5e-10 PFAM
Pfam:RCC1 958 1006 4.8e-15 PFAM
Pfam:PHR 1235 1385 8.2e-44 PFAM
Pfam:PHR 1723 1880 1.4e-43 PFAM
low complexity region 1935 1948 N/A INTRINSIC
low complexity region 2182 2195 N/A INTRINSIC
Pfam:Filamin 2261 2431 7.5e-9 PFAM
Pfam:SH3_3 2472 2539 4.1e-9 PFAM
internal_repeat_3 2612 2679 1.69e-7 PROSPERO
low complexity region 2701 2710 N/A INTRINSIC
low complexity region 2884 2917 N/A INTRINSIC
low complexity region 2970 2984 N/A INTRINSIC
coiled coil region 3263 3290 N/A INTRINSIC
low complexity region 3352 3365 N/A INTRINSIC
low complexity region 3418 3433 N/A INTRINSIC
low complexity region 3678 3695 N/A INTRINSIC
APC10 3810 3968 1.11e-18 SMART
low complexity region 4103 4115 N/A INTRINSIC
low complexity region 4190 4212 N/A INTRINSIC
Blast:BBOX 4327 4370 7e-7 BLAST
RING 4496 4546 5.35e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160758
AA Change: Q3810P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124601
Gene: ENSMUSG00000033004
AA Change: Q3810P

DomainStartEndE-ValueType
low complexity region 14 22 N/A INTRINSIC
low complexity region 67 94 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Pfam:RCC1_2 650 679 1e-10 PFAM
low complexity region 704 717 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
Pfam:RCC1_2 909 938 1.5e-9 PFAM
Pfam:RCC1 925 973 1.3e-15 PFAM
Pfam:PHR 1202 1353 1.6e-50 PFAM
Pfam:PHR 1690 1848 3.1e-58 PFAM
low complexity region 1902 1915 N/A INTRINSIC
low complexity region 2149 2162 N/A INTRINSIC
Pfam:Filamin 2228 2398 7.6e-9 PFAM
Pfam:SH3_3 2439 2507 2.3e-10 PFAM
internal_repeat_3 2554 2621 2e-7 PROSPERO
low complexity region 2643 2652 N/A INTRINSIC
low complexity region 2774 2807 N/A INTRINSIC
low complexity region 2860 2874 N/A INTRINSIC
coiled coil region 3153 3180 N/A INTRINSIC
low complexity region 3242 3255 N/A INTRINSIC
low complexity region 3308 3323 N/A INTRINSIC
low complexity region 3568 3585 N/A INTRINSIC
APC10 3700 3858 1.11e-18 SMART
low complexity region 3993 4005 N/A INTRINSIC
low complexity region 4080 4102 N/A INTRINSIC
Blast:BBOX 4217 4260 7e-7 BLAST
RING 4386 4436 5.35e-5 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124443
Gene: ENSMUSG00000033004
AA Change: Q633P

DomainStartEndE-ValueType
low complexity region 66 79 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
low complexity region 392 409 N/A INTRINSIC
APC10 524 682 1.11e-18 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 907 929 N/A INTRINSIC
Blast:BBOX 1042 1085 2e-6 BLAST
RING 1213 1263 5.35e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal lethality, defective diaphragm innervation, abnormal brain morphology and defective axonal guidance. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5) Chemically induced(3)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 G A 2: 20,885,524 (GRCm39) S551L possibly damaging Het
Ash1l T C 3: 88,914,571 (GRCm39) S1734P probably benign Het
Btnl2 T A 17: 34,582,288 (GRCm39) S285T possibly damaging Het
Cadm4 A G 7: 24,202,970 (GRCm39) D364G possibly damaging Het
Card6 T A 15: 5,128,347 (GRCm39) K1016N possibly damaging Het
Cdh2 G T 18: 16,757,341 (GRCm39) N692K probably benign Het
Cep76 G T 18: 67,774,219 (GRCm39) S9* probably null Het
Cklf T C 8: 104,977,729 (GRCm39) probably null Het
Ctsa T C 2: 164,681,152 (GRCm39) *475R probably null Het
Dapk1 A C 13: 60,873,715 (GRCm39) D406A probably benign Het
Ddx4 A T 13: 112,748,647 (GRCm39) V443D probably damaging Het
Dph5 C T 3: 115,693,399 (GRCm39) Q106* probably null Het
Drg2 C T 11: 60,353,026 (GRCm39) R220* probably null Het
Efcab8 A T 2: 153,652,832 (GRCm39) Q509L unknown Het
Efs C T 14: 55,154,907 (GRCm39) S444N probably benign Het
Evl T C 12: 108,614,723 (GRCm39) V58A probably damaging Het
Garin3 A G 11: 46,295,730 (GRCm39) N34S Het
Gbe1 G A 16: 70,230,500 (GRCm39) R166H probably damaging Het
Gcc1 T C 6: 28,418,785 (GRCm39) E516G probably damaging Het
Ghr T C 15: 3,487,439 (GRCm39) T15A probably benign Het
Gnb4 G A 3: 32,650,480 (GRCm39) T50M probably damaging Het
Grik3 T C 4: 125,550,190 (GRCm39) probably null Het
Gstk1 T C 6: 42,224,686 (GRCm39) Y135H probably benign Het
Gucy2c T A 6: 136,685,404 (GRCm39) I846F probably damaging Het
Itga7 A G 10: 128,778,835 (GRCm39) T321A probably benign Het
Jakmip1 A T 5: 37,332,524 (GRCm39) N1068I probably damaging Het
Krt36 A G 11: 99,994,966 (GRCm39) I202T possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Mast2 A G 4: 116,170,070 (GRCm39) L741P probably damaging Het
Mctp2 T C 7: 71,776,935 (GRCm39) N720S possibly damaging Het
Mmp9 A T 2: 164,790,956 (GRCm39) K115* probably null Het
Mtf2 C T 5: 108,228,743 (GRCm39) R20* probably null Het
Myom2 A T 8: 15,158,454 (GRCm39) H802L probably benign Het
Naa25 A G 5: 121,545,276 (GRCm39) N27D probably damaging Het
Necab2 T C 8: 120,181,103 (GRCm39) F126L probably damaging Het
Nisch C G 14: 30,896,608 (GRCm39) probably benign Het
Nsd2 T A 5: 34,000,938 (GRCm39) S152T probably damaging Het
Ntsr1 T C 2: 180,180,483 (GRCm39) L263P probably damaging Het
Nup210 A G 6: 90,995,759 (GRCm39) V922A possibly damaging Het
Or12d17 T A 17: 37,777,994 (GRCm39) M299K probably benign Het
Or5b105 T A 19: 13,080,417 (GRCm39) I84F probably benign Het
Or5d45 A C 2: 88,153,425 (GRCm39) I208S probably benign Het
Pccb C A 9: 100,909,137 (GRCm39) C144F probably damaging Het
Pi16 C A 17: 29,538,208 (GRCm39) P7Q possibly damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Prdm1 A G 10: 44,334,478 (GRCm39) V16A probably benign Het
Prr5 A C 15: 84,649,933 (GRCm39) Y219S probably damaging Het
Psme4 A G 11: 30,824,245 (GRCm39) D1743G probably benign Het
Rad21l G T 2: 151,497,045 (GRCm39) D356E probably benign Het
Rars1 A G 11: 35,710,793 (GRCm39) I322T probably damaging Het
Retreg2 C A 1: 75,123,185 (GRCm39) P319Q possibly damaging Het
Robo2 T C 16: 73,770,059 (GRCm39) Y559C probably damaging Het
Ror1 T C 4: 100,298,564 (GRCm39) Y646H probably damaging Het
Rrp15 A G 1: 186,481,373 (GRCm39) S45P probably benign Het
Sacs G C 14: 61,429,652 (GRCm39) K570N probably benign Het
Serpinb8 C T 1: 107,534,723 (GRCm39) Q265* probably null Het
Sgo2b T C 8: 64,380,318 (GRCm39) E838G probably damaging Het
Slc2a12 G A 10: 22,540,568 (GRCm39) R141K probably damaging Het
Strc G T 2: 121,208,219 (GRCm39) T384N probably benign Het
Tcaf2 T C 6: 42,606,033 (GRCm39) S547G possibly damaging Het
Tekt5 T C 16: 10,200,792 (GRCm39) N243S possibly damaging Het
Tgm3 A G 2: 129,883,819 (GRCm39) I492M probably benign Het
Tgm7 G A 2: 120,934,421 (GRCm39) T157I probably benign Het
Trnp1 C A 4: 133,225,350 (GRCm39) R140L possibly damaging Het
Ttn A G 2: 76,609,777 (GRCm39) V15797A probably damaging Het
Ugp2 A T 11: 21,283,762 (GRCm39) S102T probably benign Het
Vav2 A T 2: 27,172,299 (GRCm39) probably null Het
Vmn1r202 T A 13: 22,686,241 (GRCm39) I59F probably damaging Het
Yju2b T C 8: 84,988,411 (GRCm39) E72G probably damaging Het
Zfp109 T C 7: 23,928,570 (GRCm39) T288A probably benign Het
Zscan12 T A 13: 21,553,374 (GRCm39) H399Q probably damaging Het
Other mutations in Mycbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mycbp2 APN 14 103,460,486 (GRCm39) missense probably damaging 1.00
IGL00518:Mycbp2 APN 14 103,393,244 (GRCm39) missense probably damaging 1.00
IGL00650:Mycbp2 APN 14 103,380,664 (GRCm39) missense probably damaging 0.97
IGL00653:Mycbp2 APN 14 103,380,664 (GRCm39) missense probably damaging 0.97
IGL00742:Mycbp2 APN 14 103,438,788 (GRCm39) missense probably damaging 1.00
IGL00755:Mycbp2 APN 14 103,432,057 (GRCm39) missense possibly damaging 0.72
IGL00793:Mycbp2 APN 14 103,364,189 (GRCm39) missense possibly damaging 0.77
IGL00916:Mycbp2 APN 14 103,528,719 (GRCm39) splice site probably benign
IGL00960:Mycbp2 APN 14 103,466,820 (GRCm39) missense possibly damaging 0.95
IGL00977:Mycbp2 APN 14 103,410,078 (GRCm39) missense probably damaging 0.98
IGL01349:Mycbp2 APN 14 103,359,983 (GRCm39) missense probably damaging 0.98
IGL01369:Mycbp2 APN 14 103,392,946 (GRCm39) missense possibly damaging 0.61
IGL01410:Mycbp2 APN 14 103,466,928 (GRCm39) splice site probably null
IGL01586:Mycbp2 APN 14 103,378,305 (GRCm39) critical splice donor site probably null
IGL01593:Mycbp2 APN 14 103,528,723 (GRCm39) critical splice donor site probably null
IGL01693:Mycbp2 APN 14 103,365,415 (GRCm39) missense probably damaging 0.99
IGL01730:Mycbp2 APN 14 103,372,640 (GRCm39) nonsense probably null
IGL01820:Mycbp2 APN 14 103,425,937 (GRCm39) missense probably damaging 1.00
IGL01974:Mycbp2 APN 14 103,380,647 (GRCm39) missense possibly damaging 0.88
IGL02071:Mycbp2 APN 14 103,392,343 (GRCm39) nonsense probably null
IGL02178:Mycbp2 APN 14 103,461,802 (GRCm39) missense probably benign 0.01
IGL02324:Mycbp2 APN 14 103,479,643 (GRCm39) missense probably damaging 1.00
IGL02442:Mycbp2 APN 14 103,551,811 (GRCm39) missense probably benign
IGL02607:Mycbp2 APN 14 103,522,709 (GRCm39) missense probably damaging 1.00
IGL02679:Mycbp2 APN 14 103,442,621 (GRCm39) missense probably benign
IGL02702:Mycbp2 APN 14 103,457,560 (GRCm39) missense probably benign 0.01
IGL02709:Mycbp2 APN 14 103,392,697 (GRCm39) missense probably damaging 0.97
IGL02736:Mycbp2 APN 14 103,351,678 (GRCm39) splice site probably benign
IGL02866:Mycbp2 APN 14 103,367,428 (GRCm39) missense probably damaging 0.98
IGL02939:Mycbp2 APN 14 103,414,715 (GRCm39) missense probably benign
IGL03082:Mycbp2 APN 14 103,441,805 (GRCm39) missense probably benign 0.23
IGL03142:Mycbp2 APN 14 103,536,212 (GRCm39) missense probably damaging 0.99
IGL03155:Mycbp2 APN 14 103,392,889 (GRCm39) missense probably benign 0.06
IGL03236:Mycbp2 APN 14 103,536,134 (GRCm39) missense probably damaging 0.99
IGL03256:Mycbp2 APN 14 103,426,025 (GRCm39) missense possibly damaging 0.92
IGL03303:Mycbp2 APN 14 103,485,194 (GRCm39) missense probably damaging 1.00
compost UTSW 14 103,393,889 (GRCm39) missense probably damaging 1.00
decompose UTSW 14 103,457,415 (GRCm39) missense probably benign 0.12
moulder UTSW 14 103,426,028 (GRCm39) missense probably damaging 1.00
N/A - 293:Mycbp2 UTSW 14 103,461,898 (GRCm39) splice site probably benign
R0040:Mycbp2 UTSW 14 103,461,708 (GRCm39) missense probably benign 0.11
R0040:Mycbp2 UTSW 14 103,461,708 (GRCm39) missense probably benign 0.11
R0057:Mycbp2 UTSW 14 103,389,578 (GRCm39) missense probably damaging 0.97
R0063:Mycbp2 UTSW 14 103,394,070 (GRCm39) unclassified probably benign
R0097:Mycbp2 UTSW 14 103,393,198 (GRCm39) missense probably damaging 1.00
R0097:Mycbp2 UTSW 14 103,393,198 (GRCm39) missense probably damaging 1.00
R0268:Mycbp2 UTSW 14 103,551,761 (GRCm39) nonsense probably null
R0388:Mycbp2 UTSW 14 103,394,103 (GRCm39) missense probably benign 0.01
R0410:Mycbp2 UTSW 14 103,372,569 (GRCm39) missense probably damaging 1.00
R0530:Mycbp2 UTSW 14 103,419,895 (GRCm39) missense probably damaging 1.00
R0591:Mycbp2 UTSW 14 103,433,827 (GRCm39) unclassified probably benign
R0671:Mycbp2 UTSW 14 103,432,024 (GRCm39) missense possibly damaging 0.95
R0755:Mycbp2 UTSW 14 103,412,230 (GRCm39) missense probably damaging 1.00
R0817:Mycbp2 UTSW 14 103,466,854 (GRCm39) missense probably damaging 0.99
R0818:Mycbp2 UTSW 14 103,466,854 (GRCm39) missense probably damaging 0.99
R0819:Mycbp2 UTSW 14 103,466,854 (GRCm39) missense probably damaging 0.99
R0881:Mycbp2 UTSW 14 103,457,449 (GRCm39) missense probably benign
R0903:Mycbp2 UTSW 14 103,513,293 (GRCm39) missense probably damaging 0.99
R0940:Mycbp2 UTSW 14 103,500,129 (GRCm39) unclassified probably benign
R0961:Mycbp2 UTSW 14 103,422,271 (GRCm39) missense probably damaging 1.00
R1004:Mycbp2 UTSW 14 103,378,353 (GRCm39) missense probably benign 0.00
R1138:Mycbp2 UTSW 14 103,412,262 (GRCm39) missense possibly damaging 0.84
R1170:Mycbp2 UTSW 14 103,437,588 (GRCm39) nonsense probably null
R1211:Mycbp2 UTSW 14 103,357,999 (GRCm39) missense probably benign 0.31
R1268:Mycbp2 UTSW 14 103,446,218 (GRCm39) missense probably damaging 1.00
R1298:Mycbp2 UTSW 14 103,393,334 (GRCm39) missense probably damaging 1.00
R1341:Mycbp2 UTSW 14 103,536,303 (GRCm39) splice site probably benign
R1469:Mycbp2 UTSW 14 103,425,956 (GRCm39) missense probably damaging 0.99
R1469:Mycbp2 UTSW 14 103,425,956 (GRCm39) missense probably damaging 0.99
R1513:Mycbp2 UTSW 14 103,441,825 (GRCm39) missense probably damaging 1.00
R1528:Mycbp2 UTSW 14 103,470,033 (GRCm39) missense possibly damaging 0.91
R1564:Mycbp2 UTSW 14 103,407,287 (GRCm39) splice site probably null
R1565:Mycbp2 UTSW 14 103,489,945 (GRCm39) missense possibly damaging 0.82
R1656:Mycbp2 UTSW 14 103,485,194 (GRCm39) missense probably damaging 1.00
R1694:Mycbp2 UTSW 14 103,464,947 (GRCm39) missense probably damaging 1.00
R1709:Mycbp2 UTSW 14 103,461,852 (GRCm39) missense probably damaging 1.00
R1728:Mycbp2 UTSW 14 103,392,614 (GRCm39) missense probably damaging 0.98
R1751:Mycbp2 UTSW 14 103,485,841 (GRCm39) missense probably damaging 0.98
R1767:Mycbp2 UTSW 14 103,485,841 (GRCm39) missense probably damaging 0.98
R1772:Mycbp2 UTSW 14 103,419,855 (GRCm39) missense probably damaging 1.00
R1784:Mycbp2 UTSW 14 103,392,614 (GRCm39) missense probably damaging 0.98
R1823:Mycbp2 UTSW 14 103,489,945 (GRCm39) missense possibly damaging 0.82
R1824:Mycbp2 UTSW 14 103,489,945 (GRCm39) missense possibly damaging 0.82
R1844:Mycbp2 UTSW 14 103,393,150 (GRCm39) missense possibly damaging 0.94
R1916:Mycbp2 UTSW 14 103,422,319 (GRCm39) missense probably damaging 1.00
R1944:Mycbp2 UTSW 14 103,466,840 (GRCm39) missense probably damaging 1.00
R1983:Mycbp2 UTSW 14 103,383,407 (GRCm39) missense probably damaging 0.97
R2002:Mycbp2 UTSW 14 103,485,839 (GRCm39) missense probably damaging 0.98
R2031:Mycbp2 UTSW 14 103,426,028 (GRCm39) missense probably damaging 1.00
R2035:Mycbp2 UTSW 14 103,497,675 (GRCm39) missense probably damaging 1.00
R2048:Mycbp2 UTSW 14 103,469,960 (GRCm39) critical splice donor site probably null
R2061:Mycbp2 UTSW 14 103,524,696 (GRCm39) missense probably damaging 0.99
R2113:Mycbp2 UTSW 14 103,457,512 (GRCm39) missense probably damaging 0.99
R2128:Mycbp2 UTSW 14 103,438,666 (GRCm39) missense probably benign 0.01
R2134:Mycbp2 UTSW 14 103,446,329 (GRCm39) missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103,446,329 (GRCm39) missense probably damaging 1.00
R2135:Mycbp2 UTSW 14 103,383,378 (GRCm39) missense probably benign
R2146:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2147:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2148:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2150:Mycbp2 UTSW 14 103,393,358 (GRCm39) missense probably damaging 0.97
R2163:Mycbp2 UTSW 14 103,407,291 (GRCm39) critical splice donor site probably null
R2248:Mycbp2 UTSW 14 103,407,295 (GRCm39) missense possibly damaging 0.50
R2265:Mycbp2 UTSW 14 103,500,185 (GRCm39) missense probably benign 0.39
R2272:Mycbp2 UTSW 14 103,381,774 (GRCm39) missense probably null 0.66
R2379:Mycbp2 UTSW 14 103,412,386 (GRCm39) missense probably benign
R2495:Mycbp2 UTSW 14 103,437,554 (GRCm39) missense probably damaging 0.99
R2508:Mycbp2 UTSW 14 103,368,681 (GRCm39) missense probably damaging 0.99
R2510:Mycbp2 UTSW 14 103,392,691 (GRCm39) missense probably damaging 0.96
R2851:Mycbp2 UTSW 14 103,381,769 (GRCm39) missense probably damaging 0.99
R2852:Mycbp2 UTSW 14 103,381,769 (GRCm39) missense probably damaging 0.99
R2965:Mycbp2 UTSW 14 103,534,794 (GRCm39) missense probably benign 0.00
R3156:Mycbp2 UTSW 14 103,446,179 (GRCm39) splice site probably benign
R3404:Mycbp2 UTSW 14 103,437,550 (GRCm39) missense probably damaging 0.99
R3410:Mycbp2 UTSW 14 103,372,553 (GRCm39) missense probably damaging 1.00
R3429:Mycbp2 UTSW 14 103,466,866 (GRCm39) missense probably damaging 1.00
R3706:Mycbp2 UTSW 14 103,393,850 (GRCm39) missense probably benign 0.31
R3772:Mycbp2 UTSW 14 103,371,224 (GRCm39) missense possibly damaging 0.82
R3778:Mycbp2 UTSW 14 103,434,721 (GRCm39) missense probably damaging 0.99
R3883:Mycbp2 UTSW 14 103,532,686 (GRCm39) missense probably damaging 0.97
R3884:Mycbp2 UTSW 14 103,532,686 (GRCm39) missense probably damaging 0.97
R3887:Mycbp2 UTSW 14 103,412,233 (GRCm39) missense probably damaging 0.98
R3923:Mycbp2 UTSW 14 103,364,149 (GRCm39) missense probably damaging 1.00
R3926:Mycbp2 UTSW 14 103,441,936 (GRCm39) missense probably damaging 1.00
R3959:Mycbp2 UTSW 14 103,532,688 (GRCm39) missense probably benign 0.00
R3966:Mycbp2 UTSW 14 103,376,161 (GRCm39) splice site probably benign
R4021:Mycbp2 UTSW 14 103,389,593 (GRCm39) missense probably damaging 0.97
R4363:Mycbp2 UTSW 14 103,485,893 (GRCm39) missense probably damaging 1.00
R4405:Mycbp2 UTSW 14 103,360,881 (GRCm39) missense probably damaging 1.00
R4407:Mycbp2 UTSW 14 103,524,664 (GRCm39) missense probably damaging 1.00
R4410:Mycbp2 UTSW 14 103,372,702 (GRCm39) missense probably damaging 1.00
R4434:Mycbp2 UTSW 14 103,371,225 (GRCm39) missense probably damaging 0.99
R4448:Mycbp2 UTSW 14 103,425,938 (GRCm39) missense possibly damaging 0.89
R4452:Mycbp2 UTSW 14 103,393,094 (GRCm39) missense probably damaging 0.99
R4573:Mycbp2 UTSW 14 103,583,733 (GRCm39) missense probably benign 0.05
R4589:Mycbp2 UTSW 14 103,414,749 (GRCm39) missense probably benign 0.04
R4621:Mycbp2 UTSW 14 103,457,415 (GRCm39) missense probably benign 0.12
R4622:Mycbp2 UTSW 14 103,457,415 (GRCm39) missense probably benign 0.12
R4729:Mycbp2 UTSW 14 103,426,027 (GRCm39) missense probably damaging 1.00
R4770:Mycbp2 UTSW 14 103,457,380 (GRCm39) missense probably benign 0.41
R4790:Mycbp2 UTSW 14 103,466,873 (GRCm39) missense probably damaging 1.00
R4884:Mycbp2 UTSW 14 103,448,731 (GRCm39) missense probably damaging 1.00
R4885:Mycbp2 UTSW 14 103,383,382 (GRCm39) missense possibly damaging 0.86
R4956:Mycbp2 UTSW 14 103,524,675 (GRCm39) missense probably damaging 0.99
R4980:Mycbp2 UTSW 14 103,497,821 (GRCm39) splice site probably null
R4994:Mycbp2 UTSW 14 103,407,430 (GRCm39) missense probably benign
R5029:Mycbp2 UTSW 14 103,393,946 (GRCm39) missense probably benign 0.21
R5038:Mycbp2 UTSW 14 103,534,375 (GRCm39) missense probably damaging 1.00
R5044:Mycbp2 UTSW 14 103,376,671 (GRCm39) critical splice donor site probably null
R5231:Mycbp2 UTSW 14 103,583,650 (GRCm39) critical splice donor site probably null
R5305:Mycbp2 UTSW 14 103,583,757 (GRCm39) missense probably benign 0.00
R5322:Mycbp2 UTSW 14 103,423,119 (GRCm39) critical splice acceptor site probably null
R5376:Mycbp2 UTSW 14 103,479,868 (GRCm39) nonsense probably null
R5414:Mycbp2 UTSW 14 103,543,697 (GRCm39) missense probably damaging 1.00
R5453:Mycbp2 UTSW 14 103,438,837 (GRCm39) missense probably damaging 0.99
R5462:Mycbp2 UTSW 14 103,437,562 (GRCm39) missense probably damaging 1.00
R5499:Mycbp2 UTSW 14 103,479,615 (GRCm39) missense probably damaging 1.00
R5502:Mycbp2 UTSW 14 103,411,250 (GRCm39) missense probably damaging 1.00
R5524:Mycbp2 UTSW 14 103,532,673 (GRCm39) missense probably damaging 1.00
R5533:Mycbp2 UTSW 14 103,520,081 (GRCm39) nonsense probably null
R5569:Mycbp2 UTSW 14 103,372,679 (GRCm39) missense probably damaging 1.00
R5574:Mycbp2 UTSW 14 103,380,203 (GRCm39) missense possibly damaging 0.94
R5579:Mycbp2 UTSW 14 103,528,769 (GRCm39) missense probably damaging 0.98
R5590:Mycbp2 UTSW 14 103,360,791 (GRCm39) missense probably damaging 1.00
R5592:Mycbp2 UTSW 14 103,432,113 (GRCm39) missense probably benign 0.02
R5643:Mycbp2 UTSW 14 103,524,770 (GRCm39) missense probably damaging 1.00
R5644:Mycbp2 UTSW 14 103,524,770 (GRCm39) missense probably damaging 1.00
R5645:Mycbp2 UTSW 14 103,426,051 (GRCm39) critical splice acceptor site probably null
R5645:Mycbp2 UTSW 14 103,426,044 (GRCm39) missense probably damaging 1.00
R5646:Mycbp2 UTSW 14 103,407,346 (GRCm39) missense probably benign 0.09
R5648:Mycbp2 UTSW 14 103,528,778 (GRCm39) missense probably damaging 1.00
R5651:Mycbp2 UTSW 14 103,520,101 (GRCm39) missense probably null 0.99
R5668:Mycbp2 UTSW 14 103,357,955 (GRCm39) missense possibly damaging 0.62
R5745:Mycbp2 UTSW 14 103,393,889 (GRCm39) missense possibly damaging 0.94
R5751:Mycbp2 UTSW 14 103,385,986 (GRCm39) missense probably damaging 0.99
R5756:Mycbp2 UTSW 14 103,371,410 (GRCm39) missense probably damaging 0.99
R5837:Mycbp2 UTSW 14 103,361,839 (GRCm39) missense probably damaging 1.00
R5984:Mycbp2 UTSW 14 103,364,120 (GRCm39) missense probably damaging 0.98
R6005:Mycbp2 UTSW 14 103,394,159 (GRCm39) missense probably benign
R6063:Mycbp2 UTSW 14 103,372,582 (GRCm39) missense probably damaging 1.00
R6091:Mycbp2 UTSW 14 103,460,482 (GRCm39) missense probably damaging 1.00
R6120:Mycbp2 UTSW 14 103,513,323 (GRCm39) missense probably benign 0.01
R6129:Mycbp2 UTSW 14 103,522,836 (GRCm39) missense probably benign 0.21
R6147:Mycbp2 UTSW 14 103,392,945 (GRCm39) nonsense probably null
R6161:Mycbp2 UTSW 14 103,536,183 (GRCm39) missense probably damaging 1.00
R6187:Mycbp2 UTSW 14 103,384,453 (GRCm39) missense probably damaging 1.00
R6208:Mycbp2 UTSW 14 103,532,664 (GRCm39) missense probably benign 0.11
R6228:Mycbp2 UTSW 14 103,497,665 (GRCm39) missense probably benign 0.24
R6301:Mycbp2 UTSW 14 103,392,862 (GRCm39) missense probably damaging 1.00
R6311:Mycbp2 UTSW 14 103,500,176 (GRCm39) missense possibly damaging 0.93
R6329:Mycbp2 UTSW 14 103,393,288 (GRCm39) missense probably benign 0.00
R6439:Mycbp2 UTSW 14 103,392,911 (GRCm39) missense probably benign 0.00
R6462:Mycbp2 UTSW 14 103,373,993 (GRCm39) critical splice donor site probably null
R6528:Mycbp2 UTSW 14 103,380,317 (GRCm39) missense probably damaging 0.99
R6736:Mycbp2 UTSW 14 103,429,003 (GRCm39) missense probably null 1.00
R6821:Mycbp2 UTSW 14 103,376,845 (GRCm39) missense probably damaging 1.00
R6851:Mycbp2 UTSW 14 103,497,630 (GRCm39) critical splice donor site probably null
R6948:Mycbp2 UTSW 14 103,522,703 (GRCm39) missense possibly damaging 0.94
R6977:Mycbp2 UTSW 14 103,392,342 (GRCm39) missense probably damaging 0.99
R6985:Mycbp2 UTSW 14 103,444,117 (GRCm39) missense possibly damaging 0.79
R7035:Mycbp2 UTSW 14 103,412,417 (GRCm39) missense probably benign
R7054:Mycbp2 UTSW 14 103,393,534 (GRCm39) missense possibly damaging 0.90
R7108:Mycbp2 UTSW 14 103,360,039 (GRCm39) missense probably damaging 1.00
R7117:Mycbp2 UTSW 14 103,391,513 (GRCm39) missense probably benign 0.21
R7137:Mycbp2 UTSW 14 103,520,115 (GRCm39) missense possibly damaging 0.94
R7169:Mycbp2 UTSW 14 103,497,636 (GRCm39) missense possibly damaging 0.78
R7218:Mycbp2 UTSW 14 103,371,282 (GRCm39) missense probably benign
R7234:Mycbp2 UTSW 14 103,452,773 (GRCm39) missense probably damaging 0.98
R7238:Mycbp2 UTSW 14 103,393,733 (GRCm39) missense probably damaging 1.00
R7244:Mycbp2 UTSW 14 103,446,345 (GRCm39) missense probably damaging 0.98
R7265:Mycbp2 UTSW 14 103,434,679 (GRCm39) critical splice donor site probably null
R7286:Mycbp2 UTSW 14 103,358,027 (GRCm39) missense probably damaging 1.00
R7332:Mycbp2 UTSW 14 103,434,793 (GRCm39) missense probably damaging 0.97
R7332:Mycbp2 UTSW 14 103,393,889 (GRCm39) missense probably damaging 1.00
R7384:Mycbp2 UTSW 14 103,513,829 (GRCm39) missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103,480,564 (GRCm39) missense probably damaging 0.99
R7392:Mycbp2 UTSW 14 103,389,627 (GRCm39) missense probably damaging 1.00
R7409:Mycbp2 UTSW 14 103,526,180 (GRCm39) missense probably damaging 1.00
R7486:Mycbp2 UTSW 14 103,434,690 (GRCm39) missense probably damaging 0.97
R7643:Mycbp2 UTSW 14 103,583,701 (GRCm39) missense probably benign
R7661:Mycbp2 UTSW 14 103,450,059 (GRCm39) missense probably damaging 1.00
R7663:Mycbp2 UTSW 14 103,429,045 (GRCm39) missense probably damaging 0.99
R7730:Mycbp2 UTSW 14 103,360,791 (GRCm39) missense probably damaging 0.99
R7757:Mycbp2 UTSW 14 103,429,055 (GRCm39) missense probably damaging 1.00
R7773:Mycbp2 UTSW 14 103,485,840 (GRCm39) missense probably damaging 0.97
R7787:Mycbp2 UTSW 14 103,364,533 (GRCm39) missense probably damaging 1.00
R7838:Mycbp2 UTSW 14 103,414,729 (GRCm39) missense probably benign 0.10
R7841:Mycbp2 UTSW 14 103,384,267 (GRCm39) critical splice donor site probably null
R7858:Mycbp2 UTSW 14 103,393,741 (GRCm39) missense probably damaging 1.00
R7873:Mycbp2 UTSW 14 103,393,582 (GRCm39) missense probably damaging 1.00
R7911:Mycbp2 UTSW 14 103,437,621 (GRCm39) missense probably damaging 0.99
R7942:Mycbp2 UTSW 14 103,392,674 (GRCm39) missense probably damaging 0.99
R7951:Mycbp2 UTSW 14 103,452,898 (GRCm39) missense probably damaging 0.99
R7958:Mycbp2 UTSW 14 103,367,400 (GRCm39) missense probably benign 0.00
R8235:Mycbp2 UTSW 14 103,436,110 (GRCm39) missense probably damaging 0.99
R8246:Mycbp2 UTSW 14 103,392,640 (GRCm39) missense probably damaging 0.99
R8338:Mycbp2 UTSW 14 103,372,701 (GRCm39) missense probably damaging 1.00
R8343:Mycbp2 UTSW 14 103,398,111 (GRCm39) splice site probably null
R8361:Mycbp2 UTSW 14 103,376,250 (GRCm39) missense probably damaging 1.00
R8490:Mycbp2 UTSW 14 103,446,267 (GRCm39) missense probably benign 0.00
R8524:Mycbp2 UTSW 14 103,392,895 (GRCm39) missense probably benign 0.23
R8525:Mycbp2 UTSW 14 103,450,155 (GRCm39) missense probably damaging 1.00
R8711:Mycbp2 UTSW 14 103,407,430 (GRCm39) missense probably benign 0.08
R8735:Mycbp2 UTSW 14 103,460,586 (GRCm39) missense probably damaging 0.99
R8825:Mycbp2 UTSW 14 103,466,871 (GRCm39) missense probably damaging 1.00
R8928:Mycbp2 UTSW 14 103,393,781 (GRCm39) missense probably benign
R8974:Mycbp2 UTSW 14 103,361,857 (GRCm39) missense probably damaging 1.00
R8987:Mycbp2 UTSW 14 103,446,232 (GRCm39) missense probably damaging 1.00
R9021:Mycbp2 UTSW 14 103,551,752 (GRCm39) missense probably benign 0.08
R9062:Mycbp2 UTSW 14 103,479,796 (GRCm39) missense probably benign 0.00
R9077:Mycbp2 UTSW 14 103,469,974 (GRCm39) missense probably damaging 1.00
R9208:Mycbp2 UTSW 14 103,532,664 (GRCm39) missense probably benign 0.01
R9285:Mycbp2 UTSW 14 103,434,753 (GRCm39) missense probably damaging 0.97
R9290:Mycbp2 UTSW 14 103,425,960 (GRCm39) missense probably damaging 0.99
R9362:Mycbp2 UTSW 14 103,497,642 (GRCm39) missense probably damaging 0.97
R9520:Mycbp2 UTSW 14 103,497,705 (GRCm39) missense probably benign 0.02
R9557:Mycbp2 UTSW 14 103,372,697 (GRCm39) missense probably benign 0.03
R9639:Mycbp2 UTSW 14 103,433,817 (GRCm39) missense probably damaging 1.00
R9666:Mycbp2 UTSW 14 103,371,474 (GRCm39) missense probably damaging 0.98
R9732:Mycbp2 UTSW 14 103,448,749 (GRCm39) missense probably damaging 1.00
R9736:Mycbp2 UTSW 14 103,434,852 (GRCm39) missense probably damaging 0.96
R9739:Mycbp2 UTSW 14 103,520,229 (GRCm39) missense probably benign 0.11
R9755:Mycbp2 UTSW 14 103,551,806 (GRCm39) missense probably benign
X0024:Mycbp2 UTSW 14 103,384,378 (GRCm39) missense probably damaging 1.00
Z1176:Mycbp2 UTSW 14 103,583,685 (GRCm39) missense probably benign
Z1176:Mycbp2 UTSW 14 103,394,073 (GRCm39) missense probably benign 0.06
Z1177:Mycbp2 UTSW 14 103,407,309 (GRCm39) missense possibly damaging 0.83
Z1177:Mycbp2 UTSW 14 103,372,559 (GRCm39) missense probably damaging 1.00
Z1177:Mycbp2 UTSW 14 103,364,499 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGATGAGTCTGAACACTCGGAG -3'
(R):5'- AGTCTCTCAGCCTGTGTTAAC -3'

Sequencing Primer
(F):5'- GAGAGTCTCAGCCTCACAGCTC -3'
(R):5'- GTTCTGTCTCCTGTAAACAAATGAC -3'
Posted On 2019-12-03