Incidental Mutation 'R7823:Ptgfrn'
ID 601985
Institutional Source Beutler Lab
Gene Symbol Ptgfrn
Ensembl Gene ENSMUSG00000027864
Gene Name prostaglandin F2 receptor negative regulator
Synonyms CD9P-1, 4833445A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7823 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 101040232-101110278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 101043409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 863 (V863I)
Ref Sequence ENSEMBL: ENSMUSP00000099755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102694]
AlphaFold Q9WV91
Predicted Effect probably damaging
Transcript: ENSMUST00000102694
AA Change: V863I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: V863I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 121 3.01e-7 SMART
IG 154 264 1.54e-4 SMART
IG 284 390 1.11e-5 SMART
IG 414 532 1.72e-2 SMART
IG 556 676 9.71e-2 SMART
IG 696 822 5.21e-2 SMART
transmembrane domain 831 853 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Alox15 C A 11: 70,344,668 V623L possibly damaging Het
Angpt4 T G 2: 151,911,366 L12R unknown Het
Cdh24 C T 14: 54,637,418 A42T probably damaging Het
Cep250 T A 2: 155,965,416 S234T possibly damaging Het
Clnk T A 5: 38,750,351 Y188F probably benign Het
Csmd2 A T 4: 128,209,905 T306S Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dgka T A 10: 128,736,266 Y50F probably benign Het
Dgkh C T 14: 78,604,481 V434I probably benign Het
Epb41 A G 4: 131,974,682 probably null Het
Fam220a A G 5: 143,563,256 D141G probably damaging Het
Fbxo11 A G 17: 87,993,182 L807S probably damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Ggt1 G A 10: 75,574,341 V36M possibly damaging Het
Gjb2 T C 14: 57,100,506 I82V probably benign Het
Gm10767 A G 13: 66,907,287 probably benign Het
Gm7579 T A 7: 142,212,570 C238S unknown Het
Hps1 G A 19: 42,755,707 T681M possibly damaging Het
Iqck T C 7: 118,872,823 Y64H probably damaging Het
Ldlr G A 9: 21,742,306 probably null Het
Macc1 A C 12: 119,447,065 K523Q probably damaging Het
Mgea5 A G 19: 45,776,915 V151A possibly damaging Het
Mon2 A T 10: 123,032,654 I498N probably damaging Het
Mphosph9 T C 5: 124,304,256 E373G probably damaging Het
Mthfr T C 4: 148,051,487 I314T probably benign Het
Mtmr4 T G 11: 87,612,189 I1023S probably damaging Het
Myo9a T A 9: 59,811,950 F507I probably damaging Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Nxpe5 A G 5: 138,239,582 R123G possibly damaging Het
Obscn T C 11: 59,107,940 S1369G probably damaging Het
Olfr1248 A G 2: 89,617,269 *308Q probably null Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Olfr420 A G 1: 174,159,688 K305R probably benign Het
Olfr553 A G 7: 102,614,957 S11P probably benign Het
Olfr820 T A 10: 130,018,267 M302K probably benign Het
Olfr983 A T 9: 40,092,348 V202E probably damaging Het
Pak6 G A 2: 118,695,312 A618T probably benign Het
Pax7 T A 4: 139,740,839 E489V probably benign Het
Phactr4 G A 4: 132,361,619 R651* probably null Het
Pik3c2b C T 1: 133,102,305 R1435C probably damaging Het
Pla2g4c A T 7: 13,330,019 I68F probably damaging Het
Plppr1 A G 4: 49,325,703 M300V probably benign Het
Rabep2 T C 7: 126,438,721 S222P probably damaging Het
Rbm20 A T 19: 53,843,354 D673V probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scn4a C A 11: 106,342,508 A413S probably damaging Het
Scn9a A T 2: 66,483,791 M1850K probably damaging Het
Sh3tc2 T A 18: 61,953,117 M1K probably null Het
Slc22a28 G A 19: 8,064,525 T439I probably benign Het
Slc25a36 A G 9: 97,084,391 probably null Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata3 T C 1: 86,022,059 probably benign Het
Srp68 C T 11: 116,265,439 R159Q probably damaging Het
Ssbp2 C A 13: 91,642,329 L104I possibly damaging Het
St8sia3 T A 18: 64,266,956 F7L probably benign Het
Stard9 T C 2: 120,702,106 V2948A probably damaging Het
Syne4 A G 7: 30,318,855 T341A probably benign Het
Tcf7l2 T A 19: 55,743,089 D91E possibly damaging Het
Tekt5 T A 16: 10,386,079 I236F probably damaging Het
Tlk2 T C 11: 105,253,307 Y316H probably damaging Het
Tmem184b C T 15: 79,365,291 A326T probably benign Het
Tnks2 G A 19: 36,852,554 probably null Het
Trpc4 C A 3: 54,302,219 Y668* probably null Het
Ttc9c A T 19: 8,815,922 F118Y probably benign Het
Ulk1 C T 5: 110,798,914 C95Y probably damaging Het
Vars2 A C 17: 35,659,136 L787R probably damaging Het
Vwa3a T C 7: 120,772,962 S254P probably damaging Het
Wdr81 T C 11: 75,449,801 Y1250C probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zbtb38 A T 9: 96,685,976 C1018* probably null Het
Zfp622 C T 15: 25,984,623 T25M probably damaging Het
Other mutations in Ptgfrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ptgfrn APN 3 101072845 missense probably benign 0.01
IGL01710:Ptgfrn APN 3 101073088 missense probably damaging 0.98
IGL02557:Ptgfrn APN 3 101060636 critical splice donor site probably null
IGL02740:Ptgfrn APN 3 101072937 missense possibly damaging 0.84
IGL02817:Ptgfrn APN 3 101060752 missense probably benign
IGL02948:Ptgfrn APN 3 101072819 missense probably benign 0.21
R1540:Ptgfrn UTSW 3 101060654 missense probably benign 0.41
R1563:Ptgfrn UTSW 3 101060651 missense possibly damaging 0.67
R1730:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1766:Ptgfrn UTSW 3 101050122 missense probably benign 0.00
R1783:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1918:Ptgfrn UTSW 3 101056307 missense probably benign
R2113:Ptgfrn UTSW 3 101077309 missense probably benign 0.00
R2290:Ptgfrn UTSW 3 101077361 missense possibly damaging 0.77
R3522:Ptgfrn UTSW 3 101043402 missense probably damaging 1.00
R5223:Ptgfrn UTSW 3 101045593 missense probably benign 0.13
R5600:Ptgfrn UTSW 3 101056250 missense probably damaging 0.99
R5642:Ptgfrn UTSW 3 101043362 missense probably damaging 1.00
R5927:Ptgfrn UTSW 3 101060652 missense possibly damaging 0.92
R5984:Ptgfrn UTSW 3 101050143 missense probably damaging 0.99
R6124:Ptgfrn UTSW 3 101073089 missense probably damaging 0.98
R6331:Ptgfrn UTSW 3 101045620 missense possibly damaging 0.64
R6363:Ptgfrn UTSW 3 101045578 missense possibly damaging 0.93
R6473:Ptgfrn UTSW 3 101045639 missense probably damaging 1.00
R6856:Ptgfrn UTSW 3 101045446 missense probably damaging 1.00
R7151:Ptgfrn UTSW 3 101080195 nonsense probably null
R7313:Ptgfrn UTSW 3 101073047 missense possibly damaging 0.84
R7361:Ptgfrn UTSW 3 101077444 missense probably benign 0.03
R7806:Ptgfrn UTSW 3 101077132 missense possibly damaging 0.50
R7841:Ptgfrn UTSW 3 101060810 missense probably damaging 0.98
R8093:Ptgfrn UTSW 3 101056437 missense probably benign 0.19
R8093:Ptgfrn UTSW 3 101072941 missense probably benign 0.09
R8490:Ptgfrn UTSW 3 101056370 missense probably damaging 0.99
R8856:Ptgfrn UTSW 3 101056611 missense possibly damaging 0.86
Z1088:Ptgfrn UTSW 3 101056437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAAACATGTCCTCGCTCAGAAC -3'
(R):5'- ACTAAGGAGTGAGCCAGTGC -3'

Sequencing Primer
(F):5'- TCGCTCAGAACTTGACATGCAG -3'
(R):5'- AGTGCTCTCTACCCTCCAG -3'
Posted On 2019-12-03