Mutagenetix > Incidental Mutations

Incidental Mutation 'R7823:Ptgfrn'

601985

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7823 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101043409 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 863 (V863I)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably damaging
Transcript: ENSMUST00000102694
AA Change: V863I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: V863I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (68/69)

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc4	A	G	14: 118,534,072	V869A	probably benign	Het
Alox15	C	A	11: 70,344,668	V623L	possibly damaging	Het
Angpt4	T	G	2: 151,911,366	L12R	unknown	Het
Cdh24	C	T	14: 54,637,418	A42T	probably damaging	Het
Cep250	T	A	2: 155,965,416	S234T	possibly damaging	Het
Clnk	T	A	5: 38,750,351	Y188F	probably benign	Het
Csmd2	A	T	4: 128,209,905	T306S		Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Dgka	T	A	10: 128,736,266	Y50F	probably benign	Het
Dgkh	C	T	14: 78,604,481	V434I	probably benign	Het
Epb41	A	G	4: 131,974,682		probably null	Het
Fam220a	A	G	5: 143,563,256	D141G	probably damaging	Het
Fbxo11	A	G	17: 87,993,182	L807S	probably damaging	Het
G530012D18Rik	G	C	1: 85,577,202		probably benign	Het
Ggt1	G	A	10: 75,574,341	V36M	possibly damaging	Het
Gjb2	T	C	14: 57,100,506	I82V	probably benign	Het
Gm10767	A	G	13: 66,907,287		probably benign	Het
Gm7579	T	A	7: 142,212,570	C238S	unknown	Het
Hps1	G	A	19: 42,755,707	T681M	possibly damaging	Het
Iqck	T	C	7: 118,872,823	Y64H	probably damaging	Het
Ldlr	G	A	9: 21,742,306		probably null	Het
Macc1	A	C	12: 119,447,065	K523Q	probably damaging	Het
Mgea5	A	G	19: 45,776,915	V151A	possibly damaging	Het
Mon2	A	T	10: 123,032,654	I498N	probably damaging	Het
Mphosph9	T	C	5: 124,304,256	E373G	probably damaging	Het
Mthfr	T	C	4: 148,051,487	I314T	probably benign	Het
Mtmr4	T	G	11: 87,612,189	I1023S	probably damaging	Het
Myo9a	T	A	9: 59,811,950	F507I	probably damaging	Het
Nlrp10	T	A	7: 108,924,261	M671L	probably benign	Het
Nt5c1a	T	C	4: 123,208,572	V97A	probably damaging	Het
Nxpe5	A	G	5: 138,239,582	R123G	possibly damaging	Het
Obscn	T	C	11: 59,107,940	S1369G	probably damaging	Het
Olfr1248	A	G	2: 89,617,269	*308Q	probably null	Het
Olfr1451	A	T	19: 12,999,417	I144F	probably damaging	Het
Olfr420	A	G	1: 174,159,688	K305R	probably benign	Het
Olfr553	A	G	7: 102,614,957	S11P	probably benign	Het
Olfr820	T	A	10: 130,018,267	M302K	probably benign	Het
Olfr983	A	T	9: 40,092,348	V202E	probably damaging	Het
Pak6	G	A	2: 118,695,312	A618T	probably benign	Het
Pax7	T	A	4: 139,740,839	E489V	probably benign	Het
Phactr4	G	A	4: 132,361,619	R651*	probably null	Het
Pik3c2b	C	T	1: 133,102,305	R1435C	probably damaging	Het
Pla2g4c	A	T	7: 13,330,019	I68F	probably damaging	Het
Plppr1	A	G	4: 49,325,703	M300V	probably benign	Het
Rabep2	T	C	7: 126,438,721	S222P	probably damaging	Het
Rbm20	A	T	19: 53,843,354	D673V	probably benign	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Scn4a	C	A	11: 106,342,508	A413S	probably damaging	Het
Scn9a	A	T	2: 66,483,791	M1850K	probably damaging	Het
Sh3tc2	T	A	18: 61,953,117	M1K	probably null	Het
Slc22a28	G	A	19: 8,064,525	T439I	probably benign	Het
Slc25a36	A	G	9: 97,084,391		probably null	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Spata3	T	C	1: 86,022,059		probably benign	Het
Srp68	C	T	11: 116,265,439	R159Q	probably damaging	Het
Ssbp2	C	A	13: 91,642,329	L104I	possibly damaging	Het
St8sia3	T	A	18: 64,266,956	F7L	probably benign	Het
Stard9	T	C	2: 120,702,106	V2948A	probably damaging	Het
Syne4	A	G	7: 30,318,855	T341A	probably benign	Het
Tcf7l2	T	A	19: 55,743,089	D91E	possibly damaging	Het
Tekt5	T	A	16: 10,386,079	I236F	probably damaging	Het
Tlk2	T	C	11: 105,253,307	Y316H	probably damaging	Het
Tmem184b	C	T	15: 79,365,291	A326T	probably benign	Het
Tnks2	G	A	19: 36,852,554		probably null	Het
Trpc4	C	A	3: 54,302,219	Y668*	probably null	Het
Ttc9c	A	T	19: 8,815,922	F118Y	probably benign	Het
Ulk1	C	T	5: 110,798,914	C95Y	probably damaging	Het
Vars2	A	C	17: 35,659,136	L787R	probably damaging	Het
Vwa3a	T	C	7: 120,772,962	S254P	probably damaging	Het
Wdr81	T	C	11: 75,449,801	Y1250C	probably damaging	Het
Xirp2	A	T	2: 67,511,774	D1453V	probably damaging	Het
Zbtb38	A	T	9: 96,685,976	C1018*	probably null	Het
Zfp622	C	T	15: 25,984,623	T25M	probably damaging	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTAAACATGTCCTCGCTCAGAAC -3'
(R):5'- ACTAAGGAGTGAGCCAGTGC -3'

Sequencing Primer
(F):5'- TCGCTCAGAACTTGACATGCAG -3'
(R):5'- AGTGCTCTCTACCCTCCAG -3'

Posted On

2019-12-03