Incidental Mutation 'R7823:Plppr1'
ID601986
Institutional Source Beutler Lab
Gene Symbol Plppr1
Ensembl Gene ENSMUSG00000063446
Gene Namephospholipid phosphatase related 1
SynonymsPRG-3, E130309F12Rik, Lppr1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R7823 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location49059273-49340259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49325703 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 300 (M300V)
Ref Sequence ENSEMBL: ENSMUSP00000075966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076670]
Predicted Effect probably benign
Transcript: ENSMUST00000076670
AA Change: M300V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000075966
Gene: ENSMUSG00000063446
AA Change: M300V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
acidPPc 128 272 4.47e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plasticity-related gene (PRG) family. Members of the PRG family mediate lipid phosphate phosphatase activity in neurons and are known to be involved in neuronal plasticity. The protein encoded by this gene does not perform its function through enzymatic phospholipid degradation. This gene is strongly expressed in brain. It shows dynamic expression regulation during brain development and neuronal excitation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Alox15 C A 11: 70,344,668 V623L possibly damaging Het
Angpt4 T G 2: 151,911,366 L12R unknown Het
Cdh24 C T 14: 54,637,418 A42T probably damaging Het
Cep250 T A 2: 155,965,416 S234T possibly damaging Het
Clnk T A 5: 38,750,351 Y188F probably benign Het
Csmd2 A T 4: 128,209,905 T306S Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dgka T A 10: 128,736,266 Y50F probably benign Het
Dgkh C T 14: 78,604,481 V434I probably benign Het
Epb41 A G 4: 131,974,682 probably null Het
Fam220a A G 5: 143,563,256 D141G probably damaging Het
Fbxo11 A G 17: 87,993,182 L807S probably damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Ggt1 G A 10: 75,574,341 V36M possibly damaging Het
Gjb2 T C 14: 57,100,506 I82V probably benign Het
Gm10767 A G 13: 66,907,287 probably benign Het
Gm7579 T A 7: 142,212,570 C238S unknown Het
Hps1 G A 19: 42,755,707 T681M possibly damaging Het
Iqck T C 7: 118,872,823 Y64H probably damaging Het
Ldlr G A 9: 21,742,306 probably null Het
Macc1 A C 12: 119,447,065 K523Q probably damaging Het
Mgea5 A G 19: 45,776,915 V151A possibly damaging Het
Mon2 A T 10: 123,032,654 I498N probably damaging Het
Mphosph9 T C 5: 124,304,256 E373G probably damaging Het
Mthfr T C 4: 148,051,487 I314T probably benign Het
Mtmr4 T G 11: 87,612,189 I1023S probably damaging Het
Myo9a T A 9: 59,811,950 F507I probably damaging Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Nxpe5 A G 5: 138,239,582 R123G possibly damaging Het
Obscn T C 11: 59,107,940 S1369G probably damaging Het
Olfr1248 A G 2: 89,617,269 *308Q probably null Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Olfr420 A G 1: 174,159,688 K305R probably benign Het
Olfr553 A G 7: 102,614,957 S11P probably benign Het
Olfr820 T A 10: 130,018,267 M302K probably benign Het
Olfr983 A T 9: 40,092,348 V202E probably damaging Het
Pak6 G A 2: 118,695,312 A618T probably benign Het
Pax7 T A 4: 139,740,839 E489V probably benign Het
Phactr4 G A 4: 132,361,619 R651* probably null Het
Pik3c2b C T 1: 133,102,305 R1435C probably damaging Het
Pla2g4c A T 7: 13,330,019 I68F probably damaging Het
Ptgfrn C T 3: 101,043,409 V863I probably damaging Het
Rabep2 T C 7: 126,438,721 S222P probably damaging Het
Rbm20 A T 19: 53,843,354 D673V probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scn4a C A 11: 106,342,508 A413S probably damaging Het
Scn9a A T 2: 66,483,791 M1850K probably damaging Het
Sh3tc2 T A 18: 61,953,117 M1K probably null Het
Slc22a28 G A 19: 8,064,525 T439I probably benign Het
Slc25a36 A G 9: 97,084,391 probably null Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata3 T C 1: 86,022,059 probably benign Het
Srp68 C T 11: 116,265,439 R159Q probably damaging Het
Ssbp2 C A 13: 91,642,329 L104I possibly damaging Het
St8sia3 T A 18: 64,266,956 F7L probably benign Het
Stard9 T C 2: 120,702,106 V2948A probably damaging Het
Syne4 A G 7: 30,318,855 T341A probably benign Het
Tcf7l2 T A 19: 55,743,089 D91E possibly damaging Het
Tekt5 T A 16: 10,386,079 I236F probably damaging Het
Tlk2 T C 11: 105,253,307 Y316H probably damaging Het
Tmem184b C T 15: 79,365,291 A326T probably benign Het
Tnks2 G A 19: 36,852,554 probably null Het
Trpc4 C A 3: 54,302,219 Y668* probably null Het
Ttc9c A T 19: 8,815,922 F118Y probably benign Het
Ulk1 C T 5: 110,798,914 C95Y probably damaging Het
Vars2 A C 17: 35,659,136 L787R probably damaging Het
Vwa3a T C 7: 120,772,962 S254P probably damaging Het
Wdr81 T C 11: 75,449,801 Y1250C probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zbtb38 A T 9: 96,685,976 C1018* probably null Het
Zfp622 C T 15: 25,984,623 T25M probably damaging Het
Other mutations in Plppr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Plppr1 APN 4 49319992 missense possibly damaging 0.88
PIT4403001:Plppr1 UTSW 4 49337648 missense probably benign 0.01
R0605:Plppr1 UTSW 4 49323466 missense probably damaging 1.00
R1381:Plppr1 UTSW 4 49337674 missense possibly damaging 0.85
R1452:Plppr1 UTSW 4 49301067 splice site probably benign
R1682:Plppr1 UTSW 4 49325617 critical splice acceptor site probably null
R1980:Plppr1 UTSW 4 49337655 missense probably benign 0.09
R4261:Plppr1 UTSW 4 49300993 missense probably benign 0.09
R4674:Plppr1 UTSW 4 49323384 missense probably damaging 1.00
R5064:Plppr1 UTSW 4 49319974 missense probably benign 0.19
R5144:Plppr1 UTSW 4 49319800 missense possibly damaging 0.71
R7545:Plppr1 UTSW 4 49320002 missense possibly damaging 0.88
R8049:Plppr1 UTSW 4 49300942 missense probably benign
Z1177:Plppr1 UTSW 4 49319950 missense probably damaging 1.00
Z1177:Plppr1 UTSW 4 49319995 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCATGTACAACGGTCTGTCAC -3'
(R):5'- TAGTCAAACTGGCTTCCCATAGG -3'

Sequencing Primer
(F):5'- GGTCTGTCACTATCAGAGATGACC -3'
(R):5'- CCCATAGGAATTGTTCAAAGAACCTG -3'
Posted On2019-12-03