Incidental Mutation 'R7823:Csmd2'
ID 601988
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 045877-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R7823 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 127881650-128461449 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 128103698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 306 (T306S)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,771,484 (GRCm39) V869A probably benign Het
Alox15 C A 11: 70,235,494 (GRCm39) V623L possibly damaging Het
Angpt4 T G 2: 151,753,286 (GRCm39) L12R unknown Het
Cdh24 C T 14: 54,874,875 (GRCm39) A42T probably damaging Het
Cep250 T A 2: 155,807,336 (GRCm39) S234T possibly damaging Het
Clnk T A 5: 38,907,694 (GRCm39) Y188F probably benign Het
Cyp2f2 G A 7: 26,828,678 (GRCm39) V183I probably benign Het
Dgka T A 10: 128,572,135 (GRCm39) Y50F probably benign Het
Dgkh C T 14: 78,841,921 (GRCm39) V434I probably benign Het
Epb41 A G 4: 131,701,993 (GRCm39) probably null Het
Fam220a A G 5: 143,549,011 (GRCm39) D141G probably damaging Het
Fbxo11 A G 17: 88,300,610 (GRCm39) L807S probably damaging Het
G530012D18Rik G C 1: 85,504,923 (GRCm39) probably benign Het
Ggt1 G A 10: 75,410,175 (GRCm39) V36M possibly damaging Het
Gjb2 T C 14: 57,337,963 (GRCm39) I82V probably benign Het
Gm7579 T A 7: 141,766,307 (GRCm39) C238S unknown Het
Hps1 G A 19: 42,744,146 (GRCm39) T681M possibly damaging Het
Iqck T C 7: 118,472,046 (GRCm39) Y64H probably damaging Het
Ldlr G A 9: 21,653,602 (GRCm39) probably null Het
Macc1 A C 12: 119,410,800 (GRCm39) K523Q probably damaging Het
Mon2 A T 10: 122,868,559 (GRCm39) I498N probably damaging Het
Mphosph9 T C 5: 124,442,319 (GRCm39) E373G probably damaging Het
Mthfr T C 4: 148,135,944 (GRCm39) I314T probably benign Het
Mtmr4 T G 11: 87,503,015 (GRCm39) I1023S probably damaging Het
Myo9a T A 9: 59,719,233 (GRCm39) F507I probably damaging Het
Nlrp10 T A 7: 108,523,468 (GRCm39) M671L probably benign Het
Nt5c1a T C 4: 123,102,365 (GRCm39) V97A probably damaging Het
Nxpe5 A G 5: 138,237,844 (GRCm39) R123G possibly damaging Het
Obscn T C 11: 58,998,766 (GRCm39) S1369G probably damaging Het
Oga A G 19: 45,765,354 (GRCm39) V151A possibly damaging Het
Or4a75 A G 2: 89,447,613 (GRCm39) *308Q probably null Het
Or52m2 A G 7: 102,264,164 (GRCm39) S11P probably benign Het
Or5b99 A T 19: 12,976,781 (GRCm39) I144F probably damaging Het
Or6c33 T A 10: 129,854,136 (GRCm39) M302K probably benign Het
Or6k2 A G 1: 173,987,254 (GRCm39) K305R probably benign Het
Or8b57 A T 9: 40,003,644 (GRCm39) V202E probably damaging Het
Pak6 G A 2: 118,525,793 (GRCm39) A618T probably benign Het
Pax7 T A 4: 139,468,150 (GRCm39) E489V probably benign Het
Phactr4 G A 4: 132,088,930 (GRCm39) R651* probably null Het
Pik3c2b C T 1: 133,030,043 (GRCm39) R1435C probably damaging Het
Pla2g4c A T 7: 13,063,944 (GRCm39) I68F probably damaging Het
Plppr1 A G 4: 49,325,703 (GRCm39) M300V probably benign Het
Ptgfrn C T 3: 100,950,725 (GRCm39) V863I probably damaging Het
Rabep2 T C 7: 126,037,893 (GRCm39) S222P probably damaging Het
Ramacl A G 13: 67,055,351 (GRCm39) probably benign Het
Rbm20 A T 19: 53,831,785 (GRCm39) D673V probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Het
Scn4a C A 11: 106,233,334 (GRCm39) A413S probably damaging Het
Scn9a A T 2: 66,314,135 (GRCm39) M1850K probably damaging Het
Sh3tc2 T A 18: 62,086,188 (GRCm39) M1K probably null Het
Slc22a28 G A 19: 8,041,890 (GRCm39) T439I probably benign Het
Slc25a36 A G 9: 96,966,444 (GRCm39) probably null Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata3 T C 1: 85,949,781 (GRCm39) probably benign Het
Srp68 C T 11: 116,156,265 (GRCm39) R159Q probably damaging Het
Ssbp2 C A 13: 91,790,448 (GRCm39) L104I possibly damaging Het
St8sia3 T A 18: 64,400,027 (GRCm39) F7L probably benign Het
Stard9 T C 2: 120,532,587 (GRCm39) V2948A probably damaging Het
Syne4 A G 7: 30,018,280 (GRCm39) T341A probably benign Het
Tcf7l2 T A 19: 55,731,521 (GRCm39) D91E possibly damaging Het
Tekt5 T A 16: 10,203,943 (GRCm39) I236F probably damaging Het
Tlk2 T C 11: 105,144,133 (GRCm39) Y316H probably damaging Het
Tmem184b C T 15: 79,249,491 (GRCm39) A326T probably benign Het
Tnks2 G A 19: 36,829,954 (GRCm39) probably null Het
Trpc4 C A 3: 54,209,640 (GRCm39) Y668* probably null Het
Ttc9c A T 19: 8,793,286 (GRCm39) F118Y probably benign Het
Ulk1 C T 5: 110,946,780 (GRCm39) C95Y probably damaging Het
Vars2 A C 17: 35,970,028 (GRCm39) L787R probably damaging Het
Vwa3a T C 7: 120,372,185 (GRCm39) S254P probably damaging Het
Wdr81 T C 11: 75,340,627 (GRCm39) Y1250C probably damaging Het
Xirp2 A T 2: 67,342,118 (GRCm39) D1453V probably damaging Het
Zbtb38 A T 9: 96,568,029 (GRCm39) C1018* probably null Het
Zfp622 C T 15: 25,984,709 (GRCm39) T25M probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,377,266 (GRCm39) missense probably benign 0.03
IGL01098:Csmd2 APN 4 127,952,845 (GRCm39) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,262,923 (GRCm39) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,308,081 (GRCm39) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,308,094 (GRCm39) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,457,098 (GRCm39) nonsense probably null
IGL01670:Csmd2 APN 4 128,407,164 (GRCm39) splice site probably benign
IGL01707:Csmd2 APN 4 128,276,798 (GRCm39) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,374,638 (GRCm39) splice site probably benign
IGL01837:Csmd2 APN 4 128,313,363 (GRCm39) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,453,740 (GRCm39) missense unknown
IGL02013:Csmd2 APN 4 128,215,116 (GRCm39) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,453,672 (GRCm39) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,371,263 (GRCm39) splice site probably benign
IGL02303:Csmd2 APN 4 128,262,801 (GRCm39) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02322:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02338:Csmd2 APN 4 128,288,859 (GRCm39) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,407,165 (GRCm39) splice site probably benign
IGL02428:Csmd2 APN 4 128,368,609 (GRCm39) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,428,050 (GRCm39) missense probably benign
IGL02701:Csmd2 APN 4 128,389,934 (GRCm39) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,445,868 (GRCm39) splice site probably null
IGL02818:Csmd2 APN 4 128,103,521 (GRCm39) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,415,677 (GRCm39) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,215,128 (GRCm39) nonsense probably null
IGL02977:Csmd2 APN 4 128,387,069 (GRCm39) nonsense probably null
IGL03006:Csmd2 APN 4 128,374,558 (GRCm39) splice site probably benign
IGL03032:Csmd2 APN 4 128,412,834 (GRCm39) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,278,062 (GRCm39) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,308,092 (GRCm39) nonsense probably null
IGL03245:Csmd2 APN 4 128,402,915 (GRCm39) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,411,464 (GRCm39) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,190,222 (GRCm39) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,438,536 (GRCm39) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,389,822 (GRCm39) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,415,704 (GRCm39) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,027,466 (GRCm39) intron probably benign
R0441:Csmd2 UTSW 4 128,414,023 (GRCm39) missense probably benign 0.00
R0519:Csmd2 UTSW 4 128,380,798 (GRCm39) missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128,007,469 (GRCm39) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,308,090 (GRCm39) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,389,981 (GRCm39) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,415,807 (GRCm39) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,380,794 (GRCm39) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,377,188 (GRCm39) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,389,988 (GRCm39) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,308,185 (GRCm39) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2873:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2893:Csmd2 UTSW 4 128,432,786 (GRCm39) splice site probably null
R3796:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,215,117 (GRCm39) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,404,717 (GRCm39) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,275,738 (GRCm39) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,373,888 (GRCm39) splice site probably null
R4581:Csmd2 UTSW 4 128,262,881 (GRCm39) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,881,921 (GRCm39) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,439,866 (GRCm39) missense probably benign
R4706:Csmd2 UTSW 4 128,438,544 (GRCm39) missense probably benign
R4776:Csmd2 UTSW 4 128,336,685 (GRCm39) missense probably benign 0.09
R4838:Csmd2 UTSW 4 128,411,542 (GRCm39) missense probably benign
R4900:Csmd2 UTSW 4 128,346,318 (GRCm39) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,415,723 (GRCm39) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,215,141 (GRCm39) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 127,952,901 (GRCm39) missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128,445,828 (GRCm39) missense probably benign 0.27
R5172:Csmd2 UTSW 4 128,371,190 (GRCm39) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,439,842 (GRCm39) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,350,707 (GRCm39) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,442,612 (GRCm39) missense probably benign
R5551:Csmd2 UTSW 4 128,404,741 (GRCm39) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,356,682 (GRCm39) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,412,992 (GRCm39) splice site probably null
R5907:Csmd2 UTSW 4 128,091,178 (GRCm39) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,445,781 (GRCm39) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,439,944 (GRCm39) missense probably benign 0.00
R5977:Csmd2 UTSW 4 127,952,827 (GRCm39) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,453,739 (GRCm39) missense unknown
R6075:Csmd2 UTSW 4 128,380,658 (GRCm39) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,387,127 (GRCm39) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,294,172 (GRCm39) missense probably benign 0.00
R6366:Csmd2 UTSW 4 128,377,245 (GRCm39) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,415,743 (GRCm39) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,881,893 (GRCm39) missense probably benign 0.24
R6441:Csmd2 UTSW 4 128,288,757 (GRCm39) missense probably benign 0.03
R6643:Csmd2 UTSW 4 128,266,390 (GRCm39) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,457,164 (GRCm39) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,357,606 (GRCm39) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,091,018 (GRCm39) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,277,743 (GRCm39) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,402,952 (GRCm39) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,357,587 (GRCm39) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,336,633 (GRCm39) missense probably benign
R6882:Csmd2 UTSW 4 128,343,062 (GRCm39) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,262,856 (GRCm39) missense
R7028:Csmd2 UTSW 4 128,171,021 (GRCm39) missense
R7096:Csmd2 UTSW 4 128,356,519 (GRCm39) missense
R7122:Csmd2 UTSW 4 128,343,020 (GRCm39) missense
R7125:Csmd2 UTSW 4 128,389,955 (GRCm39) missense
R7197:Csmd2 UTSW 4 128,404,826 (GRCm39) missense
R7234:Csmd2 UTSW 4 128,350,572 (GRCm39) missense
R7299:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7301:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7319:Csmd2 UTSW 4 128,287,472 (GRCm39) missense
R7331:Csmd2 UTSW 4 128,458,021 (GRCm39) splice site probably null
R7332:Csmd2 UTSW 4 128,313,360 (GRCm39) missense
R7352:Csmd2 UTSW 4 128,451,429 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,889 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,888 (GRCm39) missense
R7474:Csmd2 UTSW 4 128,439,920 (GRCm39) missense
R7555:Csmd2 UTSW 4 128,346,251 (GRCm39) missense
R7592:Csmd2 UTSW 4 128,357,591 (GRCm39) missense
R7700:Csmd2 UTSW 4 128,439,549 (GRCm39) splice site probably null
R7714:Csmd2 UTSW 4 128,276,743 (GRCm39) nonsense probably null
R7734:Csmd2 UTSW 4 128,445,850 (GRCm39) missense
R7735:Csmd2 UTSW 4 128,350,723 (GRCm39) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,377,249 (GRCm39) missense
R7805:Csmd2 UTSW 4 128,313,366 (GRCm39) missense
R7904:Csmd2 UTSW 4 128,313,346 (GRCm39) missense
R7946:Csmd2 UTSW 4 128,414,058 (GRCm39) missense
R7964:Csmd2 UTSW 4 128,417,303 (GRCm39) missense
R7968:Csmd2 UTSW 4 128,091,118 (GRCm39) missense
R8003:Csmd2 UTSW 4 128,432,980 (GRCm39) nonsense probably null
R8071:Csmd2 UTSW 4 128,287,331 (GRCm39) missense
R8504:Csmd2 UTSW 4 128,440,483 (GRCm39) missense
R8511:Csmd2 UTSW 4 128,262,692 (GRCm39) missense
R8517:Csmd2 UTSW 4 128,446,479 (GRCm39) missense
R8704:Csmd2 UTSW 4 128,091,147 (GRCm39) missense
R8722:Csmd2 UTSW 4 128,445,743 (GRCm39) unclassified probably benign
R8729:Csmd2 UTSW 4 128,356,638 (GRCm39) missense
R8801:Csmd2 UTSW 4 128,457,195 (GRCm39) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,440,477 (GRCm39) missense
R8839:Csmd2 UTSW 4 128,336,681 (GRCm39) missense
R8867:Csmd2 UTSW 4 128,451,469 (GRCm39) missense
R8913:Csmd2 UTSW 4 128,417,351 (GRCm39) missense
R8928:Csmd2 UTSW 4 128,369,582 (GRCm39) missense
R8974:Csmd2 UTSW 4 128,446,380 (GRCm39) missense
R9001:Csmd2 UTSW 4 128,308,079 (GRCm39) missense
R9132:Csmd2 UTSW 4 128,443,007 (GRCm39) missense
R9245:Csmd2 UTSW 4 128,200,168 (GRCm39) missense
R9249:Csmd2 UTSW 4 128,313,323 (GRCm39) nonsense probably null
R9254:Csmd2 UTSW 4 128,091,112 (GRCm39) missense
R9265:Csmd2 UTSW 4 128,294,163 (GRCm39) missense
R9407:Csmd2 UTSW 4 128,442,613 (GRCm39) missense
R9432:Csmd2 UTSW 4 128,171,004 (GRCm39) missense
R9559:Csmd2 UTSW 4 128,438,561 (GRCm39) missense
R9673:Csmd2 UTSW 4 128,308,062 (GRCm39) missense
R9735:Csmd2 UTSW 4 128,402,901 (GRCm39) missense
R9749:Csmd2 UTSW 4 128,389,921 (GRCm39) missense
R9803:Csmd2 UTSW 4 128,262,986 (GRCm39) missense
Z1177:Csmd2 UTSW 4 128,424,590 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CACTCACAGGAACCTTTTGTC -3'
(R):5'- TCTCCGCTTTAAAACCACGC -3'

Sequencing Primer
(F):5'- ATGACGCCTGTGGAGGGAC -3'
(R):5'- GCAGCCAGCGATTTCTCATTAATG -3'
Posted On 2019-12-03