Incidental Mutation 'R7823:Csmd2'
ID601988
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R7823 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128209905 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 306 (T306S)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Alox15 C A 11: 70,344,668 V623L possibly damaging Het
Angpt4 T G 2: 151,911,366 L12R unknown Het
Cdh24 C T 14: 54,637,418 A42T probably damaging Het
Cep250 T A 2: 155,965,416 S234T possibly damaging Het
Clnk T A 5: 38,750,351 Y188F probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dgka T A 10: 128,736,266 Y50F probably benign Het
Dgkh C T 14: 78,604,481 V434I probably benign Het
Epb41 A G 4: 131,974,682 probably null Het
Fam220a A G 5: 143,563,256 D141G probably damaging Het
Fbxo11 A G 17: 87,993,182 L807S probably damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Ggt1 G A 10: 75,574,341 V36M possibly damaging Het
Gjb2 T C 14: 57,100,506 I82V probably benign Het
Gm10767 A G 13: 66,907,287 probably benign Het
Gm7579 T A 7: 142,212,570 C238S unknown Het
Hps1 G A 19: 42,755,707 T681M possibly damaging Het
Iqck T C 7: 118,872,823 Y64H probably damaging Het
Ldlr G A 9: 21,742,306 probably null Het
Macc1 A C 12: 119,447,065 K523Q probably damaging Het
Mgea5 A G 19: 45,776,915 V151A possibly damaging Het
Mon2 A T 10: 123,032,654 I498N probably damaging Het
Mphosph9 T C 5: 124,304,256 E373G probably damaging Het
Mthfr T C 4: 148,051,487 I314T probably benign Het
Mtmr4 T G 11: 87,612,189 I1023S probably damaging Het
Myo9a T A 9: 59,811,950 F507I probably damaging Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Nxpe5 A G 5: 138,239,582 R123G possibly damaging Het
Obscn T C 11: 59,107,940 S1369G probably damaging Het
Olfr1248 A G 2: 89,617,269 *308Q probably null Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Olfr420 A G 1: 174,159,688 K305R probably benign Het
Olfr553 A G 7: 102,614,957 S11P probably benign Het
Olfr820 T A 10: 130,018,267 M302K probably benign Het
Olfr983 A T 9: 40,092,348 V202E probably damaging Het
Pak6 G A 2: 118,695,312 A618T probably benign Het
Pax7 T A 4: 139,740,839 E489V probably benign Het
Phactr4 G A 4: 132,361,619 R651* probably null Het
Pik3c2b C T 1: 133,102,305 R1435C probably damaging Het
Pla2g4c A T 7: 13,330,019 I68F probably damaging Het
Plppr1 A G 4: 49,325,703 M300V probably benign Het
Ptgfrn C T 3: 101,043,409 V863I probably damaging Het
Rabep2 T C 7: 126,438,721 S222P probably damaging Het
Rbm20 A T 19: 53,843,354 D673V probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scn4a C A 11: 106,342,508 A413S probably damaging Het
Scn9a A T 2: 66,483,791 M1850K probably damaging Het
Sh3tc2 T A 18: 61,953,117 M1K probably null Het
Slc22a28 G A 19: 8,064,525 T439I probably benign Het
Slc25a36 A G 9: 97,084,391 probably null Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata3 T C 1: 86,022,059 probably benign Het
Srp68 C T 11: 116,265,439 R159Q probably damaging Het
Ssbp2 C A 13: 91,642,329 L104I possibly damaging Het
St8sia3 T A 18: 64,266,956 F7L probably benign Het
Stard9 T C 2: 120,702,106 V2948A probably damaging Het
Syne4 A G 7: 30,318,855 T341A probably benign Het
Tcf7l2 T A 19: 55,743,089 D91E possibly damaging Het
Tekt5 T A 16: 10,386,079 I236F probably damaging Het
Tlk2 T C 11: 105,253,307 Y316H probably damaging Het
Tmem184b C T 15: 79,365,291 A326T probably benign Het
Tnks2 G A 19: 36,852,554 probably null Het
Trpc4 C A 3: 54,302,219 Y668* probably null Het
Ttc9c A T 19: 8,815,922 F118Y probably benign Het
Ulk1 C T 5: 110,798,914 C95Y probably damaging Het
Vars2 A C 17: 35,659,136 L787R probably damaging Het
Vwa3a T C 7: 120,772,962 S254P probably damaging Het
Wdr81 T C 11: 75,449,801 Y1250C probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zbtb38 A T 9: 96,685,976 C1018* probably null Het
Zfp622 C T 15: 25,984,623 T25M probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
R8504:Csmd2 UTSW 4 128546690 missense
R8511:Csmd2 UTSW 4 128368899 missense
R8517:Csmd2 UTSW 4 128552686 missense
R8704:Csmd2 UTSW 4 128197354 missense
R8722:Csmd2 UTSW 4 128551950 unclassified probably benign
R8729:Csmd2 UTSW 4 128462845 missense
R8801:Csmd2 UTSW 4 128563402 missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128546684 missense
R8839:Csmd2 UTSW 4 128442888 missense
R8867:Csmd2 UTSW 4 128557676 missense
R8913:Csmd2 UTSW 4 128523558 missense
R8974:Csmd2 UTSW 4 128552587 missense
R9001:Csmd2 UTSW 4 128414286 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- CACTCACAGGAACCTTTTGTC -3'
(R):5'- TCTCCGCTTTAAAACCACGC -3'

Sequencing Primer
(F):5'- ATGACGCCTGTGGAGGGAC -3'
(R):5'- GCAGCCAGCGATTTCTCATTAATG -3'
Posted On2019-12-03