Incidental Mutation 'R7823:Iqck'
ID 602004
Institutional Source Beutler Lab
Gene Symbol Iqck
Ensembl Gene ENSMUSG00000073856
Gene Name IQ motif containing K
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R7823 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 118855752-118972652 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118872823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 64 (Y64H)
Ref Sequence ENSEMBL: ENSMUSP00000102157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098087] [ENSMUST00000106547] [ENSMUST00000152136]
AlphaFold D3YYL3
Predicted Effect probably damaging
Transcript: ENSMUST00000098087
AA Change: Y64H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095693
Gene: ENSMUSG00000073856
AA Change: Y64H

DomainStartEndE-ValueType
low complexity region 111 120 N/A INTRINSIC
IQ 219 241 7.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106547
AA Change: Y64H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102157
Gene: ENSMUSG00000073856
AA Change: Y64H

DomainStartEndE-ValueType
low complexity region 108 117 N/A INTRINSIC
IQ 216 238 7.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152136
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the IQ motif-containing family of proteins. The IQ motif serves as a binding site for different EF-hand proteins such as calmodulin. This gene was identified as a potential candidate gene for obsessive-compulsive disorder in a genome-wide association study. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Alox15 C A 11: 70,344,668 V623L possibly damaging Het
Angpt4 T G 2: 151,911,366 L12R unknown Het
Cdh24 C T 14: 54,637,418 A42T probably damaging Het
Cep250 T A 2: 155,965,416 S234T possibly damaging Het
Clnk T A 5: 38,750,351 Y188F probably benign Het
Csmd2 A T 4: 128,209,905 T306S Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dgka T A 10: 128,736,266 Y50F probably benign Het
Dgkh C T 14: 78,604,481 V434I probably benign Het
Epb41 A G 4: 131,974,682 probably null Het
Fam220a A G 5: 143,563,256 D141G probably damaging Het
Fbxo11 A G 17: 87,993,182 L807S probably damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Ggt1 G A 10: 75,574,341 V36M possibly damaging Het
Gjb2 T C 14: 57,100,506 I82V probably benign Het
Gm10767 A G 13: 66,907,287 probably benign Het
Gm7579 T A 7: 142,212,570 C238S unknown Het
Hps1 G A 19: 42,755,707 T681M possibly damaging Het
Ldlr G A 9: 21,742,306 probably null Het
Macc1 A C 12: 119,447,065 K523Q probably damaging Het
Mgea5 A G 19: 45,776,915 V151A possibly damaging Het
Mon2 A T 10: 123,032,654 I498N probably damaging Het
Mphosph9 T C 5: 124,304,256 E373G probably damaging Het
Mthfr T C 4: 148,051,487 I314T probably benign Het
Mtmr4 T G 11: 87,612,189 I1023S probably damaging Het
Myo9a T A 9: 59,811,950 F507I probably damaging Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Nxpe5 A G 5: 138,239,582 R123G possibly damaging Het
Obscn T C 11: 59,107,940 S1369G probably damaging Het
Olfr1248 A G 2: 89,617,269 *308Q probably null Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Olfr420 A G 1: 174,159,688 K305R probably benign Het
Olfr553 A G 7: 102,614,957 S11P probably benign Het
Olfr820 T A 10: 130,018,267 M302K probably benign Het
Olfr983 A T 9: 40,092,348 V202E probably damaging Het
Pak6 G A 2: 118,695,312 A618T probably benign Het
Pax7 T A 4: 139,740,839 E489V probably benign Het
Phactr4 G A 4: 132,361,619 R651* probably null Het
Pik3c2b C T 1: 133,102,305 R1435C probably damaging Het
Pla2g4c A T 7: 13,330,019 I68F probably damaging Het
Plppr1 A G 4: 49,325,703 M300V probably benign Het
Ptgfrn C T 3: 101,043,409 V863I probably damaging Het
Rabep2 T C 7: 126,438,721 S222P probably damaging Het
Rbm20 A T 19: 53,843,354 D673V probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scn4a C A 11: 106,342,508 A413S probably damaging Het
Scn9a A T 2: 66,483,791 M1850K probably damaging Het
Sh3tc2 T A 18: 61,953,117 M1K probably null Het
Slc22a28 G A 19: 8,064,525 T439I probably benign Het
Slc25a36 A G 9: 97,084,391 probably null Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata3 T C 1: 86,022,059 probably benign Het
Srp68 C T 11: 116,265,439 R159Q probably damaging Het
Ssbp2 C A 13: 91,642,329 L104I possibly damaging Het
St8sia3 T A 18: 64,266,956 F7L probably benign Het
Stard9 T C 2: 120,702,106 V2948A probably damaging Het
Syne4 A G 7: 30,318,855 T341A probably benign Het
Tcf7l2 T A 19: 55,743,089 D91E possibly damaging Het
Tekt5 T A 16: 10,386,079 I236F probably damaging Het
Tlk2 T C 11: 105,253,307 Y316H probably damaging Het
Tmem184b C T 15: 79,365,291 A326T probably benign Het
Tnks2 G A 19: 36,852,554 probably null Het
Trpc4 C A 3: 54,302,219 Y668* probably null Het
Ttc9c A T 19: 8,815,922 F118Y probably benign Het
Ulk1 C T 5: 110,798,914 C95Y probably damaging Het
Vars2 A C 17: 35,659,136 L787R probably damaging Het
Vwa3a T C 7: 120,772,962 S254P probably damaging Het
Wdr81 T C 11: 75,449,801 Y1250C probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zbtb38 A T 9: 96,685,976 C1018* probably null Het
Zfp622 C T 15: 25,984,623 T25M probably damaging Het
Other mutations in Iqck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Iqck APN 7 118877678 missense probably damaging 1.00
IGL02810:Iqck APN 7 118971439 missense possibly damaging 0.94
IGL03403:Iqck APN 7 118876271 missense probably benign 0.21
R0541:Iqck UTSW 7 118915594 missense probably damaging 1.00
R0781:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R0829:Iqck UTSW 7 118899888 critical splice donor site probably null
R0898:Iqck UTSW 7 118971441 missense probably damaging 0.99
R2273:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2274:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2275:Iqck UTSW 7 118899657 missense possibly damaging 0.77
R2509:Iqck UTSW 7 118876282 missense probably benign
R4033:Iqck UTSW 7 118941604 missense probably damaging 1.00
R6299:Iqck UTSW 7 118876262 missense unknown
R6520:Iqck UTSW 7 118941631 missense probably damaging 1.00
R7095:Iqck UTSW 7 118915591 missense probably damaging 1.00
R9038:Iqck UTSW 7 118899658 missense probably damaging 1.00
R9218:Iqck UTSW 7 118941679 missense probably damaging 0.98
Z1176:Iqck UTSW 7 118941654 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AATCAACCTACTAGGGCTGGAGAG -3'
(R):5'- ATGTCTCAGGCTCTAGCTCC -3'

Sequencing Primer
(F):5'- AAAGGCCCGTGTTCCATCCTAG -3'
(R):5'- AGGCTCTAGCTCCCATCTC -3'
Posted On 2019-12-03