Incidental Mutation 'R7823:Zbtb38'
ID602012
Institutional Source Beutler Lab
Gene Symbol Zbtb38
Ensembl Gene ENSMUSG00000040433
Gene Namezinc finger and BTB domain containing 38
SynonymsCIBZ, A930014K01Rik, Zenon homolog
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R7823 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location96682770-96752831 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 96685976 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1018 (C1018*)
Ref Sequence ENSEMBL: ENSMUSP00000121753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]
Predicted Effect probably null
Transcript: ENSMUST00000093798
AA Change: C1018*
SMART Domains Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: C1018*

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126066
SMART Domains Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128269
SMART Domains Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140121
SMART Domains Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000152594
AA Change: C1018*
SMART Domains Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: C1018*

DomainStartEndE-ValueType
BTB 33 131 5.68e-20 SMART
low complexity region 140 151 N/A INTRINSIC
ZnF_C2H2 340 362 7.67e-2 SMART
ZnF_C2H2 369 396 7.29e0 SMART
low complexity region 435 446 N/A INTRINSIC
ZnF_C2H2 458 480 2.2e-2 SMART
ZnF_C2H2 486 508 1.05e1 SMART
ZnF_C2H2 514 537 8.09e-1 SMART
low complexity region 911 935 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
ZnF_C2H2 1013 1035 3.63e-3 SMART
ZnF_C2H2 1041 1063 9.73e-4 SMART
ZnF_C2H2 1069 1091 1.45e-2 SMART
ZnF_C2H2 1097 1119 1.02e1 SMART
ZnF_C2H2 1128 1150 1.67e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Alox15 C A 11: 70,344,668 V623L possibly damaging Het
Angpt4 T G 2: 151,911,366 L12R unknown Het
Cdh24 C T 14: 54,637,418 A42T probably damaging Het
Cep250 T A 2: 155,965,416 S234T possibly damaging Het
Clnk T A 5: 38,750,351 Y188F probably benign Het
Csmd2 A T 4: 128,209,905 T306S Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dgka T A 10: 128,736,266 Y50F probably benign Het
Dgkh C T 14: 78,604,481 V434I probably benign Het
Epb41 A G 4: 131,974,682 probably null Het
Fam220a A G 5: 143,563,256 D141G probably damaging Het
Fbxo11 A G 17: 87,993,182 L807S probably damaging Het
Ggt1 G A 10: 75,574,341 V36M possibly damaging Het
Gjb2 T C 14: 57,100,506 I82V probably benign Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm7579 T A 7: 142,212,570 C238S unknown Het
Hps1 G A 19: 42,755,707 T681M possibly damaging Het
Iqck T C 7: 118,872,823 Y64H probably damaging Het
Ldlr G A 9: 21,742,306 probably null Het
Macc1 A C 12: 119,447,065 K523Q probably damaging Het
Mgea5 A G 19: 45,776,915 V151A possibly damaging Het
Mon2 A T 10: 123,032,654 I498N probably damaging Het
Mphosph9 T C 5: 124,304,256 E373G probably damaging Het
Mthfr T C 4: 148,051,487 I314T probably benign Het
Mtmr4 T G 11: 87,612,189 I1023S probably damaging Het
Myo9a T A 9: 59,811,950 F507I probably damaging Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Nxpe5 A G 5: 138,239,582 R123G possibly damaging Het
Obscn T C 11: 59,107,940 S1369G probably damaging Het
Olfr1248 A G 2: 89,617,269 *308Q probably null Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Olfr420 A G 1: 174,159,688 K305R probably benign Het
Olfr553 A G 7: 102,614,957 S11P probably benign Het
Olfr820 T A 10: 130,018,267 M302K probably benign Het
Olfr983 A T 9: 40,092,348 V202E probably damaging Het
Pak6 G A 2: 118,695,312 A618T probably benign Het
Pax7 T A 4: 139,740,839 E489V probably benign Het
Phactr4 G A 4: 132,361,619 R651* probably null Het
Pik3c2b C T 1: 133,102,305 R1435C probably damaging Het
Pla2g4c A T 7: 13,330,019 I68F probably damaging Het
Plppr1 A G 4: 49,325,703 M300V probably benign Het
Ptgfrn C T 3: 101,043,409 V863I probably damaging Het
Rabep2 T C 7: 126,438,721 S222P probably damaging Het
Rbm20 A T 19: 53,843,354 D673V probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scn4a C A 11: 106,342,508 A413S probably damaging Het
Scn9a A T 2: 66,483,791 M1850K probably damaging Het
Sh3tc2 T A 18: 61,953,117 M1K probably null Het
Slc22a28 G A 19: 8,064,525 T439I probably benign Het
Slc25a36 A G 9: 97,084,391 probably null Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata3 T C 1: 86,022,059 probably benign Het
Srp68 C T 11: 116,265,439 R159Q probably damaging Het
Ssbp2 C A 13: 91,642,329 L104I possibly damaging Het
St8sia3 T A 18: 64,266,956 F7L probably benign Het
Stard9 T C 2: 120,702,106 V2948A probably damaging Het
Syne4 A G 7: 30,318,855 T341A probably benign Het
Tcf7l2 T A 19: 55,743,089 D91E possibly damaging Het
Tekt5 T A 16: 10,386,079 I236F probably damaging Het
Tlk2 T C 11: 105,253,307 Y316H probably damaging Het
Tmem184b C T 15: 79,365,291 A326T probably benign Het
Tnks2 G A 19: 36,852,554 probably null Het
Trpc4 C A 3: 54,302,219 Y668* probably null Het
Ttc9c A T 19: 8,815,922 F118Y probably benign Het
Ulk1 C T 5: 110,798,914 C95Y probably damaging Het
Vars2 A C 17: 35,659,136 L787R probably damaging Het
Vwa3a T C 7: 120,772,962 S254P probably damaging Het
Wdr81 T C 11: 75,449,801 Y1250C probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zfp622 C T 15: 25,984,623 T25M probably damaging Het
Other mutations in Zbtb38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Zbtb38 APN 9 96687494 missense probably damaging 1.00
IGL01895:Zbtb38 APN 9 96688408 missense probably benign 0.00
IGL02513:Zbtb38 APN 9 96687073 missense probably damaging 1.00
IGL02649:Zbtb38 APN 9 96686619 missense probably damaging 0.96
IGL02938:Zbtb38 APN 9 96687174 missense probably benign 0.11
PIT4131001:Zbtb38 UTSW 9 96686316 missense probably damaging 1.00
R0048:Zbtb38 UTSW 9 96687676 missense probably damaging 1.00
R0152:Zbtb38 UTSW 9 96686280 missense probably damaging 1.00
R0158:Zbtb38 UTSW 9 96686940 missense possibly damaging 0.46
R0519:Zbtb38 UTSW 9 96685773 missense probably damaging 1.00
R0594:Zbtb38 UTSW 9 96685954 missense probably damaging 1.00
R1556:Zbtb38 UTSW 9 96686991 missense probably benign 0.26
R1698:Zbtb38 UTSW 9 96685462 missense probably benign
R1772:Zbtb38 UTSW 9 96688041 missense probably damaging 1.00
R1799:Zbtb38 UTSW 9 96688881 missense probably damaging 1.00
R1837:Zbtb38 UTSW 9 96686995 missense probably benign
R2446:Zbtb38 UTSW 9 96687646 missense probably damaging 1.00
R3153:Zbtb38 UTSW 9 96688249 missense probably benign 0.34
R3950:Zbtb38 UTSW 9 96687546 missense probably damaging 1.00
R4240:Zbtb38 UTSW 9 96686102 small deletion probably benign
R4630:Zbtb38 UTSW 9 96688851 missense probably damaging 1.00
R4666:Zbtb38 UTSW 9 96688383 missense probably damaging 1.00
R4732:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4733:Zbtb38 UTSW 9 96687684 missense probably damaging 1.00
R4824:Zbtb38 UTSW 9 96688201 missense probably benign 0.06
R5006:Zbtb38 UTSW 9 96685651 missense probably damaging 1.00
R5109:Zbtb38 UTSW 9 96687009 missense probably damaging 0.99
R5251:Zbtb38 UTSW 9 96687108 missense probably benign 0.43
R5396:Zbtb38 UTSW 9 96687643 missense probably damaging 1.00
R5659:Zbtb38 UTSW 9 96687420 missense probably damaging 1.00
R6249:Zbtb38 UTSW 9 96685992 missense probably damaging 0.99
R6294:Zbtb38 UTSW 9 96687229 missense probably benign 0.05
R6615:Zbtb38 UTSW 9 96686654 nonsense probably null
R6625:Zbtb38 UTSW 9 96687313 missense probably damaging 1.00
R6885:Zbtb38 UTSW 9 96686464 missense probably damaging 1.00
R7304:Zbtb38 UTSW 9 96687427 missense probably damaging 0.96
R7675:Zbtb38 UTSW 9 96685541 missense probably benign 0.00
R7900:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
R7983:Zbtb38 UTSW 9 96688936 missense probably damaging 1.00
X0066:Zbtb38 UTSW 9 96687612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTCGTGGATCTTGAGCGTC -3'
(R):5'- ATCGTGCAGAGGTGAAACTG -3'

Sequencing Primer
(F):5'- GTGTGAATGCCTTGTTACAATACTG -3'
(R):5'- GGTGAAACTGCCCCCAGATAAG -3'
Posted On2019-12-03