Incidental Mutation 'R7823:Scn4a'
ID602023
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7823 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106342508 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 413 (A413S)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably damaging
Transcript: ENSMUST00000021056
AA Change: A413S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: A413S

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A G 14: 118,534,072 V869A probably benign Het
Alox15 C A 11: 70,344,668 V623L possibly damaging Het
Angpt4 T G 2: 151,911,366 L12R unknown Het
Cdh24 C T 14: 54,637,418 A42T probably damaging Het
Cep250 T A 2: 155,965,416 S234T possibly damaging Het
Clnk T A 5: 38,750,351 Y188F probably benign Het
Csmd2 A T 4: 128,209,905 T306S Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dgka T A 10: 128,736,266 Y50F probably benign Het
Dgkh C T 14: 78,604,481 V434I probably benign Het
Epb41 A G 4: 131,974,682 probably null Het
Fam220a A G 5: 143,563,256 D141G probably damaging Het
Fbxo11 A G 17: 87,993,182 L807S probably damaging Het
G530012D18Rik G C 1: 85,577,202 probably benign Het
Ggt1 G A 10: 75,574,341 V36M possibly damaging Het
Gjb2 T C 14: 57,100,506 I82V probably benign Het
Gm10767 A G 13: 66,907,287 probably benign Het
Gm7579 T A 7: 142,212,570 C238S unknown Het
Hps1 G A 19: 42,755,707 T681M possibly damaging Het
Iqck T C 7: 118,872,823 Y64H probably damaging Het
Ldlr G A 9: 21,742,306 probably null Het
Macc1 A C 12: 119,447,065 K523Q probably damaging Het
Mgea5 A G 19: 45,776,915 V151A possibly damaging Het
Mon2 A T 10: 123,032,654 I498N probably damaging Het
Mphosph9 T C 5: 124,304,256 E373G probably damaging Het
Mthfr T C 4: 148,051,487 I314T probably benign Het
Mtmr4 T G 11: 87,612,189 I1023S probably damaging Het
Myo9a T A 9: 59,811,950 F507I probably damaging Het
Nlrp10 T A 7: 108,924,261 M671L probably benign Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Nxpe5 A G 5: 138,239,582 R123G possibly damaging Het
Obscn T C 11: 59,107,940 S1369G probably damaging Het
Olfr1248 A G 2: 89,617,269 *308Q probably null Het
Olfr1451 A T 19: 12,999,417 I144F probably damaging Het
Olfr420 A G 1: 174,159,688 K305R probably benign Het
Olfr553 A G 7: 102,614,957 S11P probably benign Het
Olfr820 T A 10: 130,018,267 M302K probably benign Het
Olfr983 A T 9: 40,092,348 V202E probably damaging Het
Pak6 G A 2: 118,695,312 A618T probably benign Het
Pax7 T A 4: 139,740,839 E489V probably benign Het
Phactr4 G A 4: 132,361,619 R651* probably null Het
Pik3c2b C T 1: 133,102,305 R1435C probably damaging Het
Pla2g4c A T 7: 13,330,019 I68F probably damaging Het
Plppr1 A G 4: 49,325,703 M300V probably benign Het
Ptgfrn C T 3: 101,043,409 V863I probably damaging Het
Rabep2 T C 7: 126,438,721 S222P probably damaging Het
Rbm20 A T 19: 53,843,354 D673V probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Scn9a A T 2: 66,483,791 M1850K probably damaging Het
Sh3tc2 T A 18: 61,953,117 M1K probably null Het
Slc22a28 G A 19: 8,064,525 T439I probably benign Het
Slc25a36 A G 9: 97,084,391 probably null Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata3 T C 1: 86,022,059 probably benign Het
Srp68 C T 11: 116,265,439 R159Q probably damaging Het
Ssbp2 C A 13: 91,642,329 L104I possibly damaging Het
St8sia3 T A 18: 64,266,956 F7L probably benign Het
Stard9 T C 2: 120,702,106 V2948A probably damaging Het
Syne4 A G 7: 30,318,855 T341A probably benign Het
Tcf7l2 T A 19: 55,743,089 D91E possibly damaging Het
Tekt5 T A 16: 10,386,079 I236F probably damaging Het
Tlk2 T C 11: 105,253,307 Y316H probably damaging Het
Tmem184b C T 15: 79,365,291 A326T probably benign Het
Tnks2 G A 19: 36,852,554 probably null Het
Trpc4 C A 3: 54,302,219 Y668* probably null Het
Ttc9c A T 19: 8,815,922 F118Y probably benign Het
Ulk1 C T 5: 110,798,914 C95Y probably damaging Het
Vars2 A C 17: 35,659,136 L787R probably damaging Het
Vwa3a T C 7: 120,772,962 S254P probably damaging Het
Wdr81 T C 11: 75,449,801 Y1250C probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zbtb38 A T 9: 96,685,976 C1018* probably null Het
Zfp622 C T 15: 25,984,623 T25M probably damaging Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCACTAAGTCCAGGCCAG -3'
(R):5'- AATATGGCTGGCTTGCTGAG -3'

Sequencing Primer
(F):5'- GGAGACCCTTGGCTCCTCATC -3'
(R):5'- GAGGATGGCCATACCTTGTCTC -3'
Posted On2019-12-03