Incidental Mutation 'R7824:Efhc1'
ID602047
Institutional Source Beutler Lab
Gene Symbol Efhc1
Ensembl Gene ENSMUSG00000041809
Gene NameEF-hand domain (C-terminal) containing 1
SynonymsmRib72-1, myoclonin1, 1700029F22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7824 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location20951626-20990841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20979461 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 515 (Y515F)
Ref Sequence ENSEMBL: ENSMUSP00000042343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038447]
Predicted Effect probably damaging
Transcript: ENSMUST00000038447
AA Change: Y515F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042343
Gene: ENSMUSG00000041809
AA Change: Y515F

DomainStartEndE-ValueType
DM10 93 198 2.74e-52 SMART
DM10 239 359 3.04e-59 SMART
DM10 416 520 8.05e-50 SMART
SCOP:d1sra__ 538 646 2e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an EF-hand-containing calcium binding protein. The encoded protein likely plays a role in calcium homeostasis. Mutations in this gene have been associated with susceptibility to juvenile myoclonic epilepsy and juvenile absence epilepsy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display myoclonus and increased susceptibility to pharmacologically induced seizures. Homozygous mice also display enlarged brain ventricles and reduced hippocampal size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Efhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Efhc1 APN 1 20979481 nonsense probably null
IGL00549:Efhc1 APN 1 20979481 nonsense probably null
IGL01611:Efhc1 APN 1 20990687 makesense probably null
IGL01916:Efhc1 APN 1 20978749 missense probably damaging 1.00
IGL02366:Efhc1 APN 1 20960262 missense probably damaging 0.99
IGL02567:Efhc1 APN 1 20972964 missense probably damaging 0.98
IGL02590:Efhc1 APN 1 20967384 missense probably damaging 1.00
IGL02869:Efhc1 APN 1 20967343 missense probably damaging 0.96
IGL03264:Efhc1 APN 1 20967491 missense probably benign
IGL03292:Efhc1 APN 1 20960272 missense possibly damaging 0.89
IGL03097:Efhc1 UTSW 1 20972825 missense probably damaging 1.00
P0023:Efhc1 UTSW 1 20955527 missense probably benign
R0180:Efhc1 UTSW 1 20967489 missense probably benign
R0220:Efhc1 UTSW 1 20967358 missense probably damaging 0.98
R0391:Efhc1 UTSW 1 20960188 missense probably damaging 1.00
R0765:Efhc1 UTSW 1 20978652 missense probably benign 0.00
R1293:Efhc1 UTSW 1 20978772 missense probably damaging 0.96
R1414:Efhc1 UTSW 1 20961289 missense probably damaging 1.00
R1644:Efhc1 UTSW 1 20967401 nonsense probably null
R1799:Efhc1 UTSW 1 20979538 missense probably benign 0.00
R1932:Efhc1 UTSW 1 20967400 missense probably damaging 1.00
R1991:Efhc1 UTSW 1 20989560 nonsense probably null
R2103:Efhc1 UTSW 1 20989560 nonsense probably null
R3956:Efhc1 UTSW 1 20978666 missense probably damaging 0.96
R4812:Efhc1 UTSW 1 20990647 missense probably damaging 0.99
R5064:Efhc1 UTSW 1 20974963 missense possibly damaging 0.91
R5562:Efhc1 UTSW 1 20972880 missense probably damaging 0.98
R5800:Efhc1 UTSW 1 20978781 missense probably benign 0.00
R5948:Efhc1 UTSW 1 20972828 missense probably damaging 0.99
R5977:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R6313:Efhc1 UTSW 1 20979428 missense possibly damaging 0.69
R6375:Efhc1 UTSW 1 20972940 missense probably benign 0.05
R6512:Efhc1 UTSW 1 20960349 missense probably damaging 0.99
R6530:Efhc1 UTSW 1 20961142 splice site probably null
R6865:Efhc1 UTSW 1 20960218 missense probably damaging 1.00
R7398:Efhc1 UTSW 1 20989520 missense probably benign
R7676:Efhc1 UTSW 1 20967369 missense probably damaging 1.00
R7719:Efhc1 UTSW 1 20979520 missense probably benign
R7775:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7778:Efhc1 UTSW 1 20979461 missense probably damaging 1.00
R7857:Efhc1 UTSW 1 20975002 missense probably benign 0.11
R7940:Efhc1 UTSW 1 20975002 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAGCAGTCCACTAGTCTGGATC -3'
(R):5'- TGAAGGAGCATGCACACCTG -3'

Sequencing Primer
(F):5'- TGGATCACAGACGCTAACCTG -3'
(R):5'- CACGTGTGCATTTATACCACATAC -3'
Posted On2019-12-03