Incidental Mutation 'R7824:Farsb'
ID602049
Institutional Source Beutler Lab
Gene Symbol Farsb
Ensembl Gene ENSMUSG00000026245
Gene Namephenylalanyl-tRNA synthetase, beta subunit
SynonymsFarsl, Frsb, PheRS alpha, Farslb
Accession Numbers

Ncbi RefSeq: NM_011811.3; MGI: 1346035

Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R7824 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location78417975-78488897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78469299 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 148 (N148D)
Ref Sequence ENSEMBL: ENSMUSP00000139933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068333] [ENSMUST00000170217] [ENSMUST00000188247] [ENSMUST00000189529] [ENSMUST00000190441]
Predicted Effect probably benign
Transcript: ENSMUST00000068333
AA Change: N247D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069508
Gene: ENSMUSG00000026245
AA Change: N247D

DomainStartEndE-ValueType
Blast:B3_4 56 95 6e-14 BLAST
B3_4 117 279 3.29e-29 SMART
B5 304 374 6.31e-17 SMART
SCOP:d1jjcb5 377 586 1e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170217
AA Change: N247D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129828
Gene: ENSMUSG00000026245
AA Change: N247D

DomainStartEndE-ValueType
Blast:B3_4 56 95 6e-14 BLAST
B3_4 117 279 3.29e-29 SMART
B5 304 374 6.31e-17 SMART
SCOP:d1jjcb5 377 586 1e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188247
AA Change: N148D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139933
Gene: ENSMUSG00000026245
AA Change: N148D

DomainStartEndE-ValueType
B3_4 18 180 2.5e-33 SMART
SCOP:d1jjcb2 204 237 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189529
SMART Domains Protein: ENSMUSP00000140001
Gene: ENSMUSG00000026245

DomainStartEndE-ValueType
PDB:3L4G|P 1 38 3e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190441
SMART Domains Protein: ENSMUSP00000140934
Gene: ENSMUSG00000026245

DomainStartEndE-ValueType
Blast:B3_4 89 128 3e-15 BLAST
Pfam:B3_4 150 206 1e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved enzyme that belongs to the aminoacyl-tRNA synthetase class IIc subfamily. This enzyme comprises the regulatory beta subunits that form a tetramer with two catalytic alpha subunits. In the presence of ATP, this tetramer is responsible for attaching L-phenylalanine to the terminal adenosine of the appropriate tRNA. A pseudogene located on chromosome 10 has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI

All alleles(15) : Targeted(2) Gene trapped(13)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Bub1b T G 2: 118,626,967 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Mfge8 G T 7: 79,145,387 probably null Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Mybpc2 G A 7: 44,504,860 probably null Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Speg T A 1: 75,384,017 probably null Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Farsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Farsb APN 1 78462993 missense probably benign 0.08
IGL01328:Farsb APN 1 78471092 missense probably benign 0.02
IGL01801:Farsb APN 1 78458579 missense probably benign 0.38
R0054:Farsb UTSW 1 78462374 nonsense probably null
R0054:Farsb UTSW 1 78462374 nonsense probably null
R1051:Farsb UTSW 1 78443650 missense possibly damaging 0.49
R1769:Farsb UTSW 1 78466983 missense probably benign 0.06
R4332:Farsb UTSW 1 78469266 missense possibly damaging 0.61
R4664:Farsb UTSW 1 78443765 missense possibly damaging 0.90
R4796:Farsb UTSW 1 78425196 makesense probably null
R4859:Farsb UTSW 1 78467972 missense probably benign 0.01
R5484:Farsb UTSW 1 78476196 missense probably damaging 1.00
R5500:Farsb UTSW 1 78471124 missense probably damaging 1.00
R5557:Farsb UTSW 1 78469251 critical splice donor site probably null
R6109:Farsb UTSW 1 78463270 critical splice donor site probably null
R6368:Farsb UTSW 1 78466965 critical splice donor site probably null
R6720:Farsb UTSW 1 78472497 missense probably damaging 1.00
R7166:Farsb UTSW 1 78471184 missense probably benign
R7184:Farsb UTSW 1 78482357 missense possibly damaging 0.86
R7233:Farsb UTSW 1 78471081 critical splice donor site probably null
R7536:Farsb UTSW 1 78443754 missense possibly damaging 0.89
R7753:Farsb UTSW 1 78480103 missense probably benign 0.25
R7916:Farsb UTSW 1 78458563 critical splice donor site probably null
R8120:Farsb UTSW 1 78462838 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTACATTTGTAGTAGCTGAAAGCAG -3'
(R):5'- GGAAATGATACATGCCCTATATCG -3'

Sequencing Primer
(F):5'- CCTGTATGAAGATCAATCAAGCTGC -3'
(R):5'- CATGCCCTATATCGAGGCATAGTTG -3'
Posted On2019-12-03