Incidental Mutation 'R7824:Primpol'
ID 602070
Institutional Source Beutler Lab
Gene Symbol Primpol
Ensembl Gene ENSMUSG00000038225
Gene Name primase and polymerase (DNA-directed)
Synonyms Ccdc111
MMRRC Submission 045878-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7824 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 47028629-47070247 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 47039459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 387 (P387Q)
Ref Sequence ENSEMBL: ENSMUSP00000036119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040468] [ENSMUST00000136335] [ENSMUST00000209787] [ENSMUST00000211400]
AlphaFold Q6P1E7
Predicted Effect probably damaging
Transcript: ENSMUST00000040468
AA Change: P387Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036119
Gene: ENSMUSG00000038225
AA Change: P387Q

DomainStartEndE-ValueType
Pfam:Herpes_UL52 384 448 1.3e-19 PFAM
low complexity region 465 478 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123328
Predicted Effect probably benign
Transcript: ENSMUST00000136335
Predicted Effect probably damaging
Transcript: ENSMUST00000209787
AA Change: P387Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000211400
AA Change: P387Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.1973 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA primase-polymerase that belongs to a superfamily of archaeao-eukaryotic primases. Members of this family have primase activity, catalyzing the synthesis of short RNA primers that serve as starting points for DNA synthesis, as well as DNA polymerase activity. The encoded protein facilitates DNA damage tolerance by mediating uninterrupted fork progression after UV irradiation and reinitiating DNA synthesis. An allelic variant in this gene is associated with myopia 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mutants are viable and fertile. Mice homozygous for another knock-out allele exhibit selective increase in C to G transversions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,273,275 (GRCm39) R396G probably damaging Het
Arhgap40 A T 2: 158,376,666 (GRCm39) R267S probably damaging Het
Asb5 A C 8: 55,037,827 (GRCm39) H173P Het
Atp6v0a2 A G 5: 124,779,443 (GRCm39) E186G probably damaging Het
Bbs2 A T 8: 94,816,388 (GRCm39) probably null Het
Bub1b T G 2: 118,457,448 (GRCm39) probably null Het
Capn7 A G 14: 31,074,367 (GRCm39) T257A probably benign Het
Chrna6 T C 8: 27,897,392 (GRCm39) I162V probably damaging Het
Cldn6 T A 17: 23,900,581 (GRCm39) C182S probably damaging Het
Cyp2f2 G A 7: 26,828,678 (GRCm39) V183I probably benign Het
Cysltr2 A G 14: 73,267,203 (GRCm39) I169T probably benign Het
Ddx11 T C 17: 66,437,543 (GRCm39) probably null Het
Efhc1 A T 1: 21,049,685 (GRCm39) Y515F probably damaging Het
Farsb T C 1: 78,445,936 (GRCm39) N148D probably benign Het
Fmnl2 C T 2: 52,963,692 (GRCm39) L275F unknown Het
Gfpt2 T G 11: 49,715,268 (GRCm39) I421R probably damaging Het
Gm8297 A G 14: 16,167,939 (GRCm39) N193S possibly damaging Het
Hic1 C T 11: 75,057,042 (GRCm39) V616M possibly damaging Het
Ica1l T G 1: 60,047,029 (GRCm39) M241L probably benign Het
Ighg3 A T 12: 113,323,426 (GRCm39) D283E Het
Ing1 A G 8: 11,611,814 (GRCm39) E178G probably benign Het
Ism2 A C 12: 87,326,634 (GRCm39) V435G probably damaging Het
Klhdc2 A G 12: 69,354,002 (GRCm39) H271R probably damaging Het
Lama1 T A 17: 68,111,468 (GRCm39) S2240T Het
Lrp2 T A 2: 69,331,883 (GRCm39) E1624V possibly damaging Het
Map3k21 C G 8: 126,637,702 (GRCm39) P96R probably benign Het
Mfge8 G T 7: 78,795,135 (GRCm39) probably null Het
Mical2 T A 7: 112,006,844 (GRCm39) Y588N probably damaging Het
Mrps15 A T 4: 125,945,170 (GRCm39) N119I probably damaging Het
Mybpc2 G A 7: 44,154,284 (GRCm39) probably null Het
Myo9a T A 9: 59,767,392 (GRCm39) H865Q probably damaging Het
Odf4 A T 11: 68,812,898 (GRCm39) S253R probably benign Het
Or6c5c A G 10: 129,298,665 (GRCm39) N40S probably damaging Het
Ovch2 A G 7: 107,388,295 (GRCm39) probably null Het
Pax8 A G 2: 24,325,913 (GRCm39) S324P possibly damaging Het
Plau A G 14: 20,892,393 (GRCm39) S393G probably benign Het
Prph2 T C 17: 47,221,732 (GRCm39) L37S possibly damaging Het
Rapgefl1 A G 11: 98,741,980 (GRCm39) N648S probably damaging Het
Rin2 T A 2: 145,703,037 (GRCm39) S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Setd6 A T 8: 96,442,866 (GRCm39) H101L probably benign Het
Sez6 T C 11: 77,865,375 (GRCm39) S671P probably damaging Het
Slc22a3 G T 17: 12,683,350 (GRCm39) A171E probably damaging Het
Son T C 16: 91,453,416 (GRCm39) L721S probably damaging Het
Spata31d1b A T 13: 59,865,047 (GRCm39) R732W possibly damaging Het
Speg T A 1: 75,360,661 (GRCm39) probably null Het
Srd5a3 T A 5: 76,302,618 (GRCm39) F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 (GRCm39) probably null Het
Tfap2b G A 1: 19,304,531 (GRCm39) G447D probably damaging Het
Thoc3 A C 13: 54,611,591 (GRCm39) F232C probably damaging Het
Togaram2 T A 17: 72,011,746 (GRCm39) M476K probably benign Het
Tpgs2 G T 18: 25,262,922 (GRCm39) F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Tube1 A G 10: 39,018,294 (GRCm39) I124V probably benign Het
Ubr5 A T 15: 37,991,566 (GRCm39) H1992Q probably damaging Het
Utrn G A 10: 12,362,354 (GRCm39) R2660C probably damaging Het
Vcan T C 13: 89,836,773 (GRCm39) T2924A probably damaging Het
Vmn2r120 T C 17: 57,832,942 (GRCm39) Y79C probably damaging Het
Vwa8 T C 14: 79,275,587 (GRCm39) V790A probably benign Het
Vwf A G 6: 125,635,778 (GRCm39) K270E Het
Zfp874b A G 13: 67,622,093 (GRCm39) F402L probably benign Het
Other mutations in Primpol
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Primpol APN 8 47,034,632 (GRCm39) missense probably damaging 0.98
IGL02421:Primpol APN 8 47,060,830 (GRCm39) splice site probably benign
IGL02886:Primpol APN 8 47,046,619 (GRCm39) nonsense probably null
IGL03244:Primpol APN 8 47,039,475 (GRCm39) missense probably damaging 1.00
R0243:Primpol UTSW 8 47,052,849 (GRCm39) missense probably damaging 1.00
R0329:Primpol UTSW 8 47,063,496 (GRCm39) missense probably damaging 0.97
R0330:Primpol UTSW 8 47,063,496 (GRCm39) missense probably damaging 0.97
R0571:Primpol UTSW 8 47,034,674 (GRCm39) missense probably damaging 1.00
R1266:Primpol UTSW 8 47,046,734 (GRCm39) missense probably damaging 1.00
R1334:Primpol UTSW 8 47,039,426 (GRCm39) missense probably damaging 1.00
R1469:Primpol UTSW 8 47,046,672 (GRCm39) missense probably benign
R1469:Primpol UTSW 8 47,046,672 (GRCm39) missense probably benign
R1524:Primpol UTSW 8 47,039,502 (GRCm39) intron probably benign
R1738:Primpol UTSW 8 47,060,873 (GRCm39) missense probably damaging 0.98
R2144:Primpol UTSW 8 47,039,378 (GRCm39) missense probably damaging 0.99
R3747:Primpol UTSW 8 47,052,848 (GRCm39) missense probably benign 0.34
R3748:Primpol UTSW 8 47,052,848 (GRCm39) missense probably benign 0.34
R3750:Primpol UTSW 8 47,052,848 (GRCm39) missense probably benign 0.34
R4378:Primpol UTSW 8 47,029,218 (GRCm39) utr 3 prime probably benign
R4855:Primpol UTSW 8 47,039,726 (GRCm39) missense probably benign 0.00
R5209:Primpol UTSW 8 47,043,295 (GRCm39) missense probably benign 0.00
R5497:Primpol UTSW 8 47,045,657 (GRCm39) nonsense probably null
R5720:Primpol UTSW 8 47,034,677 (GRCm39) missense probably damaging 1.00
R5963:Primpol UTSW 8 47,046,615 (GRCm39) missense possibly damaging 0.93
R6164:Primpol UTSW 8 47,039,477 (GRCm39) missense probably benign 0.10
R6497:Primpol UTSW 8 47,039,376 (GRCm39) critical splice donor site probably null
R6549:Primpol UTSW 8 47,058,185 (GRCm39) missense probably damaging 1.00
R7595:Primpol UTSW 8 47,063,650 (GRCm39) missense probably benign 0.00
R7775:Primpol UTSW 8 47,039,459 (GRCm39) missense probably damaging 1.00
R7778:Primpol UTSW 8 47,039,459 (GRCm39) missense probably damaging 1.00
R8055:Primpol UTSW 8 47,032,197 (GRCm39) missense probably benign 0.34
R8840:Primpol UTSW 8 47,046,731 (GRCm39) missense probably damaging 1.00
R8992:Primpol UTSW 8 47,034,597 (GRCm39) splice site probably benign
R9356:Primpol UTSW 8 47,043,318 (GRCm39) missense probably benign 0.00
R9388:Primpol UTSW 8 47,034,605 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACAGAAAGCTGGTATGTGCTAG -3'
(R):5'- AGGTAAGGCTTGGCTTTCTCTC -3'

Sequencing Primer
(F):5'- CTGGTATGTGCTAGAAGTGATTTAAC -3'
(R):5'- CCTGTTTTTCTGTTTGGTTTTTCAAG -3'
Posted On 2019-12-03