Incidental Mutation 'R7824:Setd6'
ID602073
Institutional Source Beutler Lab
Gene Symbol Setd6
Ensembl Gene ENSMUSG00000031671
Gene NameSET domain containing 6
Synonyms0610039J04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7824 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95715881-95719010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95716238 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 101 (H101L)
Ref Sequence ENSEMBL: ENSMUSP00000034096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034096] [ENSMUST00000041318] [ENSMUST00000068452] [ENSMUST00000073139] [ENSMUST00000080666] [ENSMUST00000098473] [ENSMUST00000141900] [ENSMUST00000148727] [ENSMUST00000162578] [ENSMUST00000166358] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect probably benign
Transcript: ENSMUST00000034096
AA Change: H101L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034096
Gene: ENSMUSG00000031671
AA Change: H101L

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SET 62 293 1.84e0 SMART
Pfam:Rubis-subs-bind 330 465 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041318
SMART Domains Protein: ENSMUSP00000036226
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ndr 60 342 3.1e-126 PFAM
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068452
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073139
SMART Domains Protein: ENSMUSP00000072883
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 8 290 2e-126 PFAM
Pfam:Abhydrolase_6 43 278 1.2e-16 PFAM
low complexity region 308 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080666
SMART Domains Protein: ENSMUSP00000079495
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 8 290 9.9e-127 PFAM
Pfam:Abhydrolase_6 43 278 1.1e-16 PFAM
low complexity region 295 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098473
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141900
Predicted Effect probably benign
Transcript: ENSMUST00000148727
Predicted Effect probably benign
Transcript: ENSMUST00000162578
Predicted Effect probably benign
Transcript: ENSMUST00000166358
SMART Domains Protein: ENSMUSP00000131203
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211887
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that adds a methyl group to the histone H2AZ, which is involved in nuclear receptor-dependent transcription. The protein also interacts with several endogenous proteins which are involved in nuclear hormone receptor signaling. A related pseudogene is located on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Setd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Setd6 APN 8 95716692 missense probably damaging 1.00
IGL02984:Setd6 UTSW 8 95716275 splice site probably null
R0021:Setd6 UTSW 8 95716665 missense probably damaging 1.00
R0140:Setd6 UTSW 8 95716109 missense probably damaging 1.00
R1487:Setd6 UTSW 8 95717928 missense probably damaging 1.00
R2073:Setd6 UTSW 8 95716788 missense probably damaging 1.00
R4672:Setd6 UTSW 8 95718012 missense probably null 0.11
R4817:Setd6 UTSW 8 95717055 unclassified probably benign
R5960:Setd6 UTSW 8 95716199 missense probably damaging 1.00
R7775:Setd6 UTSW 8 95716238 missense probably benign 0.05
R7778:Setd6 UTSW 8 95716238 missense probably benign 0.05
R8049:Setd6 UTSW 8 95716688 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAGTAGAAACGCCCAGCTC -3'
(R):5'- ACATGGGATGCTCCAAACG -3'

Sequencing Primer
(F):5'- AAGCGCAGTGAGGACCC -3'
(R):5'- TAAGGGCTCCAGGGTGATGC -3'
Posted On2019-12-03