Incidental Mutation 'R7824:Map3k21'
ID602074
Institutional Source Beutler Lab
Gene Symbol Map3k21
Ensembl Gene ENSMUSG00000031853
Gene Namemitogen-activated protein kinase kinase kinase 21
SynonymsBC021891
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7824 (G1)
Quality Score223.009
Status Not validated
Chromosome8
Chromosomal Location125910450-125947440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 125910963 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 96 (P96R)
Ref Sequence ENSEMBL: ENSMUSP00000034316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034316]
Predicted Effect probably benign
Transcript: ENSMUST00000034316
AA Change: P96R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000034316
Gene: ENSMUSG00000031853
AA Change: P96R

DomainStartEndE-ValueType
SH3 27 87 1.1e-18 SMART
TyrKc 110 382 6.04e-82 SMART
coiled coil region 402 474 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
low complexity region 661 677 N/A INTRINSIC
low complexity region 740 758 N/A INTRINSIC
low complexity region 766 788 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Map3k21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Map3k21 APN 8 125944673 missense possibly damaging 0.52
IGL01919:Map3k21 APN 8 125942132 missense probably damaging 0.97
IGL02065:Map3k21 APN 8 125941658 missense probably benign 0.01
IGL02123:Map3k21 APN 8 125926110 missense probably damaging 1.00
IGL02127:Map3k21 APN 8 125942147 missense probably benign
IGL02863:Map3k21 APN 8 125927541 missense probably benign 0.02
IGL03194:Map3k21 APN 8 125924062 missense possibly damaging 0.90
PIT4142001:Map3k21 UTSW 8 125937308 missense probably damaging 0.98
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0238:Map3k21 UTSW 8 125944970 missense possibly damaging 0.67
R0454:Map3k21 UTSW 8 125942119 missense probably benign
R0654:Map3k21 UTSW 8 125942020 missense probably benign 0.07
R1141:Map3k21 UTSW 8 125941732 missense probably benign 0.32
R1177:Map3k21 UTSW 8 125944838 missense probably benign 0.31
R1463:Map3k21 UTSW 8 125942137 missense probably benign 0.00
R1472:Map3k21 UTSW 8 125941678 missense probably benign
R1759:Map3k21 UTSW 8 125944780 missense probably benign
R1988:Map3k21 UTSW 8 125927555 missense probably benign 0.07
R2058:Map3k21 UTSW 8 125938722 missense probably benign 0.01
R2117:Map3k21 UTSW 8 125924042 missense probably benign 0.19
R2157:Map3k21 UTSW 8 125937266 missense probably benign
R2436:Map3k21 UTSW 8 125941615 nonsense probably null
R2507:Map3k21 UTSW 8 125939938 missense possibly damaging 0.73
R3125:Map3k21 UTSW 8 125941854 missense probably benign 0.26
R3746:Map3k21 UTSW 8 125935100 missense probably damaging 1.00
R4016:Map3k21 UTSW 8 125911185 missense probably damaging 1.00
R4647:Map3k21 UTSW 8 125942111 missense probably benign
R4648:Map3k21 UTSW 8 125942111 missense probably benign
R4864:Map3k21 UTSW 8 125927555 missense probably benign 0.04
R5642:Map3k21 UTSW 8 125938824 missense probably benign 0.17
R5694:Map3k21 UTSW 8 125944768 missense probably benign 0.04
R5950:Map3k21 UTSW 8 125941760 missense possibly damaging 0.93
R5982:Map3k21 UTSW 8 125911430 missense probably damaging 1.00
R6440:Map3k21 UTSW 8 125911137 missense probably damaging 1.00
R6550:Map3k21 UTSW 8 125937292 missense probably damaging 1.00
R6664:Map3k21 UTSW 8 125941871 missense probably benign 0.01
R6668:Map3k21 UTSW 8 125926113 missense possibly damaging 0.60
R6788:Map3k21 UTSW 8 125939866 missense probably benign 0.28
R7369:Map3k21 UTSW 8 125911116 missense possibly damaging 0.86
R7371:Map3k21 UTSW 8 125935065 missense probably damaging 0.99
R7381:Map3k21 UTSW 8 125944978 missense possibly damaging 0.83
R7388:Map3k21 UTSW 8 125927597 missense probably damaging 1.00
R7397:Map3k21 UTSW 8 125935116 missense probably damaging 1.00
R7497:Map3k21 UTSW 8 125927601 missense probably damaging 0.99
R7562:Map3k21 UTSW 8 125938800 missense probably damaging 1.00
R7564:Map3k21 UTSW 8 125927708 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTTATGATTACGAAGCGCGC -3'
(R):5'- AGTTGACCAGAACCTGTGGG -3'

Sequencing Primer
(F):5'- CGGTGAGGACGAGCTGAGC -3'
(R):5'- CCCGCAGCTGGATGATGTTG -3'
Posted On2019-12-03