Incidental Mutation 'R7824:Odf4'
ID602080
Institutional Source Beutler Lab
Gene Symbol Odf4
Ensembl Gene ENSMUSG00000032921
Gene Nameouter dense fiber of sperm tails 4
SynonymsOppo1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7824 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location68921835-68927081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68922072 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 253 (S253R)
Ref Sequence ENSEMBL: ENSMUSP00000040050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038932] [ENSMUST00000125134] [ENSMUST00000130271]
Predicted Effect probably benign
Transcript: ENSMUST00000038932
AA Change: S253R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040050
Gene: ENSMUSG00000032921
AA Change: S253R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 42 222 1.1e-8 PFAM
low complexity region 272 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125134
SMART Domains Protein: ENSMUSP00000133636
Gene: ENSMUSG00000032921

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130271
SMART Domains Protein: ENSMUSP00000134383
Gene: ENSMUSG00000032921

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156828
SMART Domains Protein: ENSMUSP00000133569
Gene: ENSMUSG00000032921

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the outer dense fibers of the tails of mature sperm. This protein is thought to have some important role in the sperm tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Odf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Odf4 APN 11 68921952 unclassified probably benign
IGL01782:Odf4 APN 11 68926633 missense probably damaging 0.98
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R0030:Odf4 UTSW 11 68926941 missense probably benign 0.33
R1945:Odf4 UTSW 11 68922157 missense possibly damaging 0.53
R4551:Odf4 UTSW 11 68922040 missense probably benign 0.02
R4552:Odf4 UTSW 11 68922040 missense probably benign 0.02
R4685:Odf4 UTSW 11 68922839 critical splice donor site probably null
R4707:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R5163:Odf4 UTSW 11 68922846 missense probably damaging 1.00
R6657:Odf4 UTSW 11 68926812 missense probably benign 0.12
R7073:Odf4 UTSW 11 68926688 missense probably damaging 1.00
R7508:Odf4 UTSW 11 68922423 missense possibly damaging 0.71
R7778:Odf4 UTSW 11 68922072 missense probably benign 0.01
X0025:Odf4 UTSW 11 68926790 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAAAGCTGGTCCCCAAATC -3'
(R):5'- AGGCAGGCAAACCCTCTCTC -3'

Sequencing Primer
(F):5'- GGTCCCCAAATCCTCCTTTG -3'
(R):5'- AGGTGGTCTTAACCTTCCCTTTGG -3'
Posted On2019-12-03