Incidental Mutation 'R7824:Klhdc2'
ID602084
Institutional Source Beutler Lab
Gene Symbol Klhdc2
Ensembl Gene ENSMUSG00000020978
Gene Namekelch domain containing 2
SynonymsHCLP-1, D12Ertd522e, 2310022K15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7824 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location69296681-69310687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69307228 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 271 (H271R)
Ref Sequence ENSEMBL: ENSMUSP00000021362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021362] [ENSMUST00000021368]
Predicted Effect probably damaging
Transcript: ENSMUST00000021362
AA Change: H271R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021362
Gene: ENSMUSG00000020978
AA Change: H271R

DomainStartEndE-ValueType
internal_repeat_1 7 117 3.66e-6 PROSPERO
internal_repeat_2 66 163 6.25e-5 PROSPERO
Pfam:Kelch_1 217 258 1.4e-6 PFAM
Pfam:Kelch_2 217 262 1.2e-7 PFAM
Pfam:Kelch_4 217 266 8.4e-8 PFAM
Pfam:Kelch_3 227 276 5.1e-9 PFAM
Pfam:Kelch_5 265 305 1.4e-6 PFAM
Pfam:Kelch_4 267 310 2e-9 PFAM
Pfam:Kelch_3 278 326 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021368
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Klhdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Klhdc2 APN 12 69303534 missense probably benign 0.04
IGL00990:Klhdc2 APN 12 69307213 missense probably benign 0.30
IGL01024:Klhdc2 APN 12 69305836 missense probably benign 0.01
IGL01457:Klhdc2 APN 12 69297053 missense probably benign
IGL01735:Klhdc2 APN 12 69300279 missense probably benign 0.39
IGL01913:Klhdc2 APN 12 69302358 missense probably benign 0.45
IGL02440:Klhdc2 APN 12 69303640 missense probably damaging 1.00
Dixit_dominus UTSW 12 69308976 nonsense probably null
R0611:Klhdc2 UTSW 12 69300279 missense probably benign 0.22
R0724:Klhdc2 UTSW 12 69297048 missense probably benign
R1350:Klhdc2 UTSW 12 69305710 critical splice donor site probably null
R1796:Klhdc2 UTSW 12 69300297 critical splice donor site probably null
R1907:Klhdc2 UTSW 12 69296960 start gained probably benign
R4418:Klhdc2 UTSW 12 69307597 unclassified probably benign
R5119:Klhdc2 UTSW 12 69296962 utr 5 prime probably benign
R5586:Klhdc2 UTSW 12 69307693 splice site probably null
R5987:Klhdc2 UTSW 12 69303613 missense possibly damaging 0.71
R6448:Klhdc2 UTSW 12 69303920 missense probably benign
R6848:Klhdc2 UTSW 12 69308976 nonsense probably null
R7844:Klhdc2 UTSW 12 69302406 missense probably damaging 1.00
R7927:Klhdc2 UTSW 12 69302406 missense probably damaging 1.00
R7969:Klhdc2 UTSW 12 69304632 splice site probably null
RF016:Klhdc2 UTSW 12 69303886 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCATTTGCCTAGTGGGAGAG -3'
(R):5'- AGCAGGGATTTTAAGTGCTCC -3'

Sequencing Primer
(F):5'- GGGCAGCAGACTCTAGGGAC -3'
(R):5'- CAGGGATTTTAAGTGCTCCATTTTTC -3'
Posted On2019-12-03