Incidental Mutation 'R7824:Ism2'
ID602085
Institutional Source Beutler Lab
Gene Symbol Ism2
Ensembl Gene ENSMUSG00000050671
Gene Nameisthmin 2
SynonymsThsd3, LOC217738
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7824 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87278638-87299705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87279860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 435 (V435G)
Ref Sequence ENSEMBL: ENSMUSP00000117108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051601] [ENSMUST00000125733]
Predicted Effect probably damaging
Transcript: ENSMUST00000051601
AA Change: V391G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053451
Gene: ENSMUSG00000050671
AA Change: V391G

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
TSP1 206 248 3.9e-7 SMART
AMOP 273 437 1.21e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125733
AA Change: V435G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117108
Gene: ENSMUSG00000050671
AA Change: V435G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 96 112 N/A INTRINSIC
TSP1 250 292 3.9e-7 SMART
AMOP 317 481 1.21e-75 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Bub1b T G 2: 118,626,967 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Mfge8 G T 7: 79,145,387 probably null Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Mybpc2 G A 7: 44,504,860 probably null Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Speg T A 1: 75,384,017 probably null Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Ism2
AlleleSourceChrCoordTypePredicted EffectPPH Score
canal UTSW 12 87280061 missense probably damaging 1.00
panamin UTSW 12 87286884 splice site probably null
Zone UTSW 12 87299663 missense unknown
PIT4243001:Ism2 UTSW 12 87287058 missense probably benign 0.00
R0544:Ism2 UTSW 12 87285339 missense probably damaging 1.00
R0747:Ism2 UTSW 12 87285398 splice site probably benign
R2258:Ism2 UTSW 12 87280074 missense possibly damaging 0.92
R2859:Ism2 UTSW 12 87299663 missense unknown
R3423:Ism2 UTSW 12 87287097 missense probably benign 0.00
R3425:Ism2 UTSW 12 87287097 missense probably benign 0.00
R4115:Ism2 UTSW 12 87287031 missense probably benign 0.02
R4713:Ism2 UTSW 12 87285027 splice site silent
R4769:Ism2 UTSW 12 87299581 missense probably benign 0.06
R5313:Ism2 UTSW 12 87279762 missense probably damaging 1.00
R5857:Ism2 UTSW 12 87280061 missense probably damaging 1.00
R5984:Ism2 UTSW 12 87287035 missense possibly damaging 0.77
R6389:Ism2 UTSW 12 87282371 missense possibly damaging 0.49
R6838:Ism2 UTSW 12 87280201 missense probably benign 0.23
R7019:Ism2 UTSW 12 87299663 missense unknown
R7358:Ism2 UTSW 12 87280040 missense probably damaging 1.00
R7427:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7428:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
R7777:Ism2 UTSW 12 87286884 splice site probably null
R7973:Ism2 UTSW 12 87286995 missense possibly damaging 0.76
Z1177:Ism2 UTSW 12 87280035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGAGCATGCTCTAATTCC -3'
(R):5'- AACATCAGGGTCGCAGCTTC -3'

Sequencing Primer
(F):5'- AGGAGCATGCTCTAATTCCTCTTTAG -3'
(R):5'- AGGGTCGCAGCTTCCAGTG -3'
Posted On2019-12-03