Incidental Mutation 'R7824:Spata31d1b'
ID602088
Institutional Source Beutler Lab
Gene Symbol Spata31d1b
Ensembl Gene ENSMUSG00000091311
Gene Namespermatogenesis associated 31 subfamily D, member 1B
SynonymsFam75d1b, Gm4934
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7824 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location59712284-59719295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59717233 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 732 (R732W)
Ref Sequence ENSEMBL: ENSMUSP00000130813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165133]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165133
AA Change: R732W

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130813
Gene: ENSMUSG00000091311
AA Change: R732W

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 65 149 3.9e-10 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 206 229 N/A INTRINSIC
low complexity region 352 360 N/A INTRINSIC
Pfam:FAM75 402 774 1.1e-116 PFAM
low complexity region 883 895 N/A INTRINSIC
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1152 1162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Spata31d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Spata31d1b APN 13 59712466 missense probably benign 0.06
IGL02317:Spata31d1b APN 13 59718040 missense probably damaging 0.99
IGL02885:Spata31d1b APN 13 59719127 utr 3 prime probably benign
R0017:Spata31d1b UTSW 13 59716069 missense probably benign
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0595:Spata31d1b UTSW 13 59716277 missense probably benign 0.09
R0961:Spata31d1b UTSW 13 59717804 missense possibly damaging 0.91
R1054:Spata31d1b UTSW 13 59717518 missense probably damaging 0.96
R1124:Spata31d1b UTSW 13 59716654 missense probably benign
R1338:Spata31d1b UTSW 13 59718161 frame shift probably null
R1539:Spata31d1b UTSW 13 59715919 missense possibly damaging 0.46
R1662:Spata31d1b UTSW 13 59716628 missense probably benign 0.00
R1688:Spata31d1b UTSW 13 59715460 missense possibly damaging 0.61
R1776:Spata31d1b UTSW 13 59716567 missense probably benign
R1793:Spata31d1b UTSW 13 59715965 missense probably benign
R1838:Spata31d1b UTSW 13 59715857 missense probably benign
R1838:Spata31d1b UTSW 13 59717465 missense probably benign 0.00
R1861:Spata31d1b UTSW 13 59717336 missense possibly damaging 0.64
R1903:Spata31d1b UTSW 13 59718068 missense probably damaging 0.99
R1940:Spata31d1b UTSW 13 59718021 missense possibly damaging 0.91
R1994:Spata31d1b UTSW 13 59716380 missense probably benign
R1995:Spata31d1b UTSW 13 59716380 missense probably benign
R2407:Spata31d1b UTSW 13 59716846 missense possibly damaging 0.64
R3692:Spata31d1b UTSW 13 59717891 missense probably benign 0.03
R4576:Spata31d1b UTSW 13 59716861 missense probably damaging 0.98
R4734:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4742:Spata31d1b UTSW 13 59716612 missense probably damaging 0.98
R4749:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4806:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4808:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4844:Spata31d1b UTSW 13 59718355 missense possibly damaging 0.85
R4942:Spata31d1b UTSW 13 59717103 missense possibly damaging 0.70
R4953:Spata31d1b UTSW 13 59716283 missense probably damaging 0.96
R5093:Spata31d1b UTSW 13 59716024 missense possibly damaging 0.84
R5169:Spata31d1b UTSW 13 59716495 missense probably damaging 1.00
R5384:Spata31d1b UTSW 13 59718218 missense possibly damaging 0.68
R5386:Spata31d1b UTSW 13 59719052 missense possibly damaging 0.95
R5502:Spata31d1b UTSW 13 59716672 missense probably damaging 1.00
R5751:Spata31d1b UTSW 13 59718973 missense probably benign 0.03
R6054:Spata31d1b UTSW 13 59715650 missense probably benign
R6433:Spata31d1b UTSW 13 59717185 missense probably damaging 0.99
R6571:Spata31d1b UTSW 13 59717455 missense probably benign
R6980:Spata31d1b UTSW 13 59715422 missense probably benign 0.26
R7047:Spata31d1b UTSW 13 59712435 missense probably damaging 1.00
R7064:Spata31d1b UTSW 13 59716141 missense probably benign
R7147:Spata31d1b UTSW 13 59718214 missense probably benign 0.28
R7273:Spata31d1b UTSW 13 59717632 missense probably benign
R7359:Spata31d1b UTSW 13 59712490 missense probably damaging 1.00
R7457:Spata31d1b UTSW 13 59716909 missense probably damaging 0.99
R7469:Spata31d1b UTSW 13 59715464 missense probably benign 0.04
R7519:Spata31d1b UTSW 13 59716912 missense probably benign 0.43
R7548:Spata31d1b UTSW 13 59716654 missense probably benign
R7586:Spata31d1b UTSW 13 59718380 missense probably damaging 1.00
R7657:Spata31d1b UTSW 13 59715763 missense possibly damaging 0.46
R7778:Spata31d1b UTSW 13 59717233 missense possibly damaging 0.65
Z1177:Spata31d1b UTSW 13 59712409 missense probably damaging 1.00
Z1177:Spata31d1b UTSW 13 59715451 missense probably benign 0.44
Z1177:Spata31d1b UTSW 13 59718860 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAGCTCTCGAAATCGGATGCC -3'
(R):5'- ACATGCCATTGGTGCCAGATC -3'

Sequencing Primer
(F):5'- CTAGAAGGCATTCTCTACGGG -3'
(R):5'- ATTGGTGCCAGATCTTTCATTCG -3'
Posted On2019-12-03