Incidental Mutation 'R7824:Cysltr2'
ID602094
Institutional Source Beutler Lab
Gene Symbol Cysltr2
Ensembl Gene ENSMUSG00000033470
Gene Namecysteinyl leukotriene receptor 2
SynonymsCYSLT2R, 2300001H05Rik, Cyslt2, CysLT2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7824 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location73025603-73049114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73029763 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 169 (I169T)
Ref Sequence ENSEMBL: ENSMUSP00000040715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044664] [ENSMUST00000169168]
Predicted Effect probably benign
Transcript: ENSMUST00000044664
AA Change: I169T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040715
Gene: ENSMUSG00000033470
AA Change: I169T

DomainStartEndE-ValueType
Pfam:TAS2R 18 307 1.6e-8 PFAM
Pfam:7tm_1 39 289 2.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169168
AA Change: I169T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125958
Gene: ENSMUSG00000033470
AA Change: I169T

DomainStartEndE-ValueType
Pfam:TAS2R 18 307 1.4e-8 PFAM
Pfam:7tm_1 39 289 1.3e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cysteinyl leukotrienes LTC4, LTD4, and LTE4 are important mediators of human bronchial asthma. Pharmacologic studies have determined that cysteinyl leukotrienes activate at least 2 receptors, the protein encoded by this gene and CYSLTR1. This encoded receptor is a member of the superfamily of G protein-coupled receptors. It seems to play a major role in endocrine and cardiovascular systems. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced bleomycin-induced pulmonary fibrosis and reduced IgE dependent passive cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Cysltr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03211:Cysltr2 APN 14 73029715 missense possibly damaging 0.90
R1223:Cysltr2 UTSW 14 73030099 missense probably damaging 1.00
R1689:Cysltr2 UTSW 14 73030030 missense possibly damaging 0.75
R1695:Cysltr2 UTSW 14 73029881 missense probably benign 0.01
R1898:Cysltr2 UTSW 14 73029533 missense probably damaging 1.00
R3968:Cysltr2 UTSW 14 73030174 missense probably damaging 0.99
R4013:Cysltr2 UTSW 14 73029565 missense probably damaging 1.00
R4357:Cysltr2 UTSW 14 73029644 missense probably benign 0.15
R4444:Cysltr2 UTSW 14 73029893 missense possibly damaging 0.74
R4445:Cysltr2 UTSW 14 73029893 missense possibly damaging 0.74
R5207:Cysltr2 UTSW 14 73029511 missense probably damaging 0.99
R5591:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5592:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5593:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5839:Cysltr2 UTSW 14 73030183 missense probably damaging 1.00
R5885:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5886:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5934:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5940:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5940:Cysltr2 UTSW 14 73029949 missense probably damaging 1.00
R7775:Cysltr2 UTSW 14 73029763 missense probably benign 0.00
R7778:Cysltr2 UTSW 14 73029763 missense probably benign 0.00
X0009:Cysltr2 UTSW 14 73029979 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCCTATGAGCAGCACGTGG -3'
(R):5'- GCCTGCAGAGTCATGTCTTATTC -3'

Sequencing Primer
(F):5'- GGACCTGATTCTGGAATCTCAGC -3'
(R):5'- AGCATTTATTTCCTAACTGTGCTGAG -3'
Posted On2019-12-03