Incidental Mutation 'R7824:Slc22a3'
ID602099
Institutional Source Beutler Lab
Gene Symbol Slc22a3
Ensembl Gene ENSMUSG00000023828
Gene Namesolute carrier family 22 (organic cation transporter), member 3
SynonymsOct3, EMT, Orct3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7824 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location12419972-12507704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12464463 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 171 (A171E)
Ref Sequence ENSEMBL: ENSMUSP00000024595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024595]
Predicted Effect probably damaging
Transcript: ENSMUST00000024595
AA Change: A171E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024595
Gene: ENSMUSG00000023828
AA Change: A171E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 105 526 1.2e-28 PFAM
Pfam:MFS_1 144 395 3.3e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to paraquat-induced dopamine neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Tpgs2 G T 18: 25,129,865 F232L probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Slc22a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Slc22a3 APN 17 12425610 missense probably damaging 1.00
IGL01343:Slc22a3 APN 17 12425629 missense probably damaging 1.00
IGL01621:Slc22a3 APN 17 12458492 missense probably benign 0.02
IGL02228:Slc22a3 APN 17 12459810 missense probably damaging 1.00
R0466:Slc22a3 UTSW 17 12458493 nonsense probably null
R1501:Slc22a3 UTSW 17 12507104 missense probably benign 0.12
R1688:Slc22a3 UTSW 17 12433807 missense probably damaging 1.00
R3030:Slc22a3 UTSW 17 12457634 missense probably benign 0.00
R4604:Slc22a3 UTSW 17 12459771 missense probably benign 0.38
R4754:Slc22a3 UTSW 17 12507195 missense probably benign 0.03
R4796:Slc22a3 UTSW 17 12423788 missense probably damaging 1.00
R4865:Slc22a3 UTSW 17 12464532 missense probably benign 0.03
R5433:Slc22a3 UTSW 17 12458490 missense probably damaging 1.00
R5483:Slc22a3 UTSW 17 12464467 missense probably damaging 0.99
R5719:Slc22a3 UTSW 17 12423804 missense probably damaging 1.00
R5750:Slc22a3 UTSW 17 12433508 missense probably benign 0.01
R5872:Slc22a3 UTSW 17 12433468 missense probably damaging 1.00
R5988:Slc22a3 UTSW 17 12433895 missense possibly damaging 0.92
R6197:Slc22a3 UTSW 17 12458551 missense probably benign 0.00
R7155:Slc22a3 UTSW 17 12433631 missense possibly damaging 0.83
R7764:Slc22a3 UTSW 17 12458496 missense probably damaging 1.00
R7775:Slc22a3 UTSW 17 12464463 missense probably damaging 1.00
X0027:Slc22a3 UTSW 17 12458471 missense possibly damaging 0.91
Z1088:Slc22a3 UTSW 17 12425681 nonsense probably null
Z1177:Slc22a3 UTSW 17 12507058 missense probably benign
Z1177:Slc22a3 UTSW 17 12507171 missense probably damaging 1.00
Z1177:Slc22a3 UTSW 17 12507175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGATGACACTGCCCTCAGG -3'
(R):5'- AAATGTGGTTGCTGTATTAGAGAGTCC -3'

Sequencing Primer
(F):5'- TCAGGTCGAGGCTTTCACCAG -3'
(R):5'- CATGTTTTGAAGATGAACCTCCCTGG -3'
Posted On2019-12-03