Incidental Mutation 'R7824:Tpgs2'
ID602106
Institutional Source Beutler Lab
Gene Symbol Tpgs2
Ensembl Gene ENSMUSG00000024269
Gene Nametubulin polyglutamylase complex subunit 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7824 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location25127223-25169007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25129865 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 232 (F232L)
Ref Sequence ENSEMBL: ENSMUSP00000122538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097] [ENSMUST00000148255]
Predicted Effect probably benign
Transcript: ENSMUST00000037097
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148255
AA Change: F232L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122538
Gene: ENSMUSG00000024269
AA Change: F232L

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,389,075 R396G probably damaging Het
Arhgap40 A T 2: 158,534,746 R267S probably damaging Het
Asb5 A C 8: 54,584,792 H173P Het
Atp6v0a2 A G 5: 124,641,505 E186G probably damaging Het
Bbs2 A T 8: 94,089,760 probably null Het
Capn7 A G 14: 31,352,410 T257A probably benign Het
Chrna6 T C 8: 27,407,364 I162V probably damaging Het
Cldn6 T A 17: 23,681,607 C182S probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cysltr2 A G 14: 73,029,763 I169T probably benign Het
Ddx11 T C 17: 66,130,548 probably null Het
Efhc1 A T 1: 20,979,461 Y515F probably damaging Het
Farsb T C 1: 78,469,299 N148D probably benign Het
Fmnl2 C T 2: 53,073,680 L275F unknown Het
Gfpt2 T G 11: 49,824,441 I421R probably damaging Het
Gm8297 A G 14: 4,986,951 N193S possibly damaging Het
Hic1 C T 11: 75,166,216 V616M possibly damaging Het
Ica1l T G 1: 60,007,870 M241L probably benign Het
Ighg3 A T 12: 113,359,806 D283E Het
Ing1 A G 8: 11,561,814 E178G probably benign Het
Ism2 A C 12: 87,279,860 V435G probably damaging Het
Klhdc2 A G 12: 69,307,228 H271R probably damaging Het
Lama1 T A 17: 67,804,473 S2240T Het
Lrp2 T A 2: 69,501,539 E1624V possibly damaging Het
Map3k21 C G 8: 125,910,963 P96R probably benign Het
Micalcl T A 7: 112,407,637 Y588N probably damaging Het
Mrps15 A T 4: 126,051,377 N119I probably damaging Het
Myo9a T A 9: 59,860,109 H865Q probably damaging Het
Odf4 A T 11: 68,922,072 S253R probably benign Het
Olfr787 A G 10: 129,462,796 N40S probably damaging Het
Ovch2 A G 7: 107,789,088 probably null Het
Pax8 A G 2: 24,435,901 S324P possibly damaging Het
Plau A G 14: 20,842,325 S393G probably benign Het
Primpol G T 8: 46,586,424 P387Q probably damaging Het
Prph2 T C 17: 46,910,806 L37S possibly damaging Het
Rapgefl1 A G 11: 98,851,154 N648S probably damaging Het
Rin2 T A 2: 145,861,117 S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd6 A T 8: 95,716,238 H101L probably benign Het
Sez6 T C 11: 77,974,549 S671P probably damaging Het
Slc22a3 G T 17: 12,464,463 A171E probably damaging Het
Son T C 16: 91,656,528 L721S probably damaging Het
Spata31d1b A T 13: 59,717,233 R732W possibly damaging Het
Srd5a3 T A 5: 76,154,771 F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 probably null Het
Tfap2b G A 1: 19,234,307 G447D probably damaging Het
Thoc3 A C 13: 54,463,778 F232C probably damaging Het
Togaram2 T A 17: 71,704,751 M476K probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 GTAA GTAAATTAA 6: 113,399,161 probably null Het
Ttll3 A AAGTAC 6: 113,399,164 probably null Het
Tube1 A G 10: 39,142,298 I124V probably benign Het
Ubr5 A T 15: 37,991,322 H1992Q probably damaging Het
Utrn G A 10: 12,486,610 R2660C probably damaging Het
Vcan T C 13: 89,688,654 T2924A probably damaging Het
Vmn1r3 G A 4: 3,185,220 P29L probably benign Het
Vmn2r120 T C 17: 57,525,942 Y79C probably damaging Het
Vwa8 T C 14: 79,038,147 V790A probably benign Het
Vwf A G 6: 125,658,815 K270E Het
Zfp874b A G 13: 67,473,974 F402L probably benign Het
Other mutations in Tpgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Tpgs2 APN 18 25140580 missense possibly damaging 0.93
IGL02184:Tpgs2 APN 18 25140573 missense probably damaging 1.00
IGL02234:Tpgs2 APN 18 25149244 critical splice acceptor site probably null
IGL02747:Tpgs2 APN 18 25139145 intron probably benign
PIT4466001:Tpgs2 UTSW 18 25168595 missense possibly damaging 0.77
PIT4472001:Tpgs2 UTSW 18 25168595 missense possibly damaging 0.77
R0004:Tpgs2 UTSW 18 25158238 splice site probably benign
R0139:Tpgs2 UTSW 18 25149185 missense probably damaging 1.00
R0898:Tpgs2 UTSW 18 25149150 missense probably damaging 1.00
R1415:Tpgs2 UTSW 18 25168553 missense probably damaging 1.00
R1590:Tpgs2 UTSW 18 25140573 missense probably damaging 1.00
R1974:Tpgs2 UTSW 18 25140536 missense probably damaging 1.00
R2144:Tpgs2 UTSW 18 25168541 missense possibly damaging 0.93
R4811:Tpgs2 UTSW 18 25129840 intron probably benign
R4851:Tpgs2 UTSW 18 25151248 missense possibly damaging 0.94
R6386:Tpgs2 UTSW 18 25139024 missense possibly damaging 0.74
R6564:Tpgs2 UTSW 18 25158287 missense probably damaging 0.99
R6788:Tpgs2 UTSW 18 25129870 missense probably benign 0.04
R7112:Tpgs2 UTSW 18 25149137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGGCACAATATCAGTGG -3'
(R):5'- TTCCTCTGGAGAGCAAACTTGC -3'

Sequencing Primer
(F):5'- CCTGTAGGCTTGTAGAACTGTACATC -3'
(R):5'- TGCCCTCTTACATCAGCAGTAGAG -3'
Posted On2019-12-03