Incidental Mutation 'R7824:Tpgs2'
ID 602106
Institutional Source Beutler Lab
Gene Symbol Tpgs2
Ensembl Gene ENSMUSG00000024269
Gene Name tubulin polyglutamylase complex subunit 2
Synonyms 5730494M16Rik, 5730437P09Rik
MMRRC Submission 045878-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7824 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 25260280-25301990 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 25262922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 232 (F232L)
Ref Sequence ENSEMBL: ENSMUSP00000122538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097] [ENSMUST00000148255]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037097
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148255
AA Change: F232L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122538
Gene: ENSMUSG00000024269
AA Change: F232L

DomainStartEndE-ValueType
SMI1_KNR4 43 187 1.04e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7a T C 15: 77,273,275 (GRCm39) R396G probably damaging Het
Arhgap40 A T 2: 158,376,666 (GRCm39) R267S probably damaging Het
Asb5 A C 8: 55,037,827 (GRCm39) H173P Het
Atp6v0a2 A G 5: 124,779,443 (GRCm39) E186G probably damaging Het
Bbs2 A T 8: 94,816,388 (GRCm39) probably null Het
Bub1b T G 2: 118,457,448 (GRCm39) probably null Het
Capn7 A G 14: 31,074,367 (GRCm39) T257A probably benign Het
Chrna6 T C 8: 27,897,392 (GRCm39) I162V probably damaging Het
Cldn6 T A 17: 23,900,581 (GRCm39) C182S probably damaging Het
Cyp2f2 G A 7: 26,828,678 (GRCm39) V183I probably benign Het
Cysltr2 A G 14: 73,267,203 (GRCm39) I169T probably benign Het
Ddx11 T C 17: 66,437,543 (GRCm39) probably null Het
Efhc1 A T 1: 21,049,685 (GRCm39) Y515F probably damaging Het
Farsb T C 1: 78,445,936 (GRCm39) N148D probably benign Het
Fmnl2 C T 2: 52,963,692 (GRCm39) L275F unknown Het
Gfpt2 T G 11: 49,715,268 (GRCm39) I421R probably damaging Het
Gm8297 A G 14: 16,167,939 (GRCm39) N193S possibly damaging Het
Hic1 C T 11: 75,057,042 (GRCm39) V616M possibly damaging Het
Ica1l T G 1: 60,047,029 (GRCm39) M241L probably benign Het
Ighg3 A T 12: 113,323,426 (GRCm39) D283E Het
Ing1 A G 8: 11,611,814 (GRCm39) E178G probably benign Het
Ism2 A C 12: 87,326,634 (GRCm39) V435G probably damaging Het
Klhdc2 A G 12: 69,354,002 (GRCm39) H271R probably damaging Het
Lama1 T A 17: 68,111,468 (GRCm39) S2240T Het
Lrp2 T A 2: 69,331,883 (GRCm39) E1624V possibly damaging Het
Map3k21 C G 8: 126,637,702 (GRCm39) P96R probably benign Het
Mfge8 G T 7: 78,795,135 (GRCm39) probably null Het
Mical2 T A 7: 112,006,844 (GRCm39) Y588N probably damaging Het
Mrps15 A T 4: 125,945,170 (GRCm39) N119I probably damaging Het
Mybpc2 G A 7: 44,154,284 (GRCm39) probably null Het
Myo9a T A 9: 59,767,392 (GRCm39) H865Q probably damaging Het
Odf4 A T 11: 68,812,898 (GRCm39) S253R probably benign Het
Or6c5c A G 10: 129,298,665 (GRCm39) N40S probably damaging Het
Ovch2 A G 7: 107,388,295 (GRCm39) probably null Het
Pax8 A G 2: 24,325,913 (GRCm39) S324P possibly damaging Het
Plau A G 14: 20,892,393 (GRCm39) S393G probably benign Het
Primpol G T 8: 47,039,459 (GRCm39) P387Q probably damaging Het
Prph2 T C 17: 47,221,732 (GRCm39) L37S possibly damaging Het
Rapgefl1 A G 11: 98,741,980 (GRCm39) N648S probably damaging Het
Rin2 T A 2: 145,703,037 (GRCm39) S533T probably benign Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Het
Setd6 A T 8: 96,442,866 (GRCm39) H101L probably benign Het
Sez6 T C 11: 77,865,375 (GRCm39) S671P probably damaging Het
Slc22a3 G T 17: 12,683,350 (GRCm39) A171E probably damaging Het
Son T C 16: 91,453,416 (GRCm39) L721S probably damaging Het
Spata31d1b A T 13: 59,865,047 (GRCm39) R732W possibly damaging Het
Speg T A 1: 75,360,661 (GRCm39) probably null Het
Srd5a3 T A 5: 76,302,618 (GRCm39) F328I probably damaging Het
Tbc1d2 C T 4: 46,637,746 (GRCm39) probably null Het
Tfap2b G A 1: 19,304,531 (GRCm39) G447D probably damaging Het
Thoc3 A C 13: 54,611,591 (GRCm39) F232C probably damaging Het
Togaram2 T A 17: 72,011,746 (GRCm39) M476K probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Tube1 A G 10: 39,018,294 (GRCm39) I124V probably benign Het
Ubr5 A T 15: 37,991,566 (GRCm39) H1992Q probably damaging Het
Utrn G A 10: 12,362,354 (GRCm39) R2660C probably damaging Het
Vcan T C 13: 89,836,773 (GRCm39) T2924A probably damaging Het
Vmn2r120 T C 17: 57,832,942 (GRCm39) Y79C probably damaging Het
Vwa8 T C 14: 79,275,587 (GRCm39) V790A probably benign Het
Vwf A G 6: 125,635,778 (GRCm39) K270E Het
Zfp874b A G 13: 67,622,093 (GRCm39) F402L probably benign Het
Other mutations in Tpgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Tpgs2 APN 18 25,273,637 (GRCm39) missense possibly damaging 0.93
IGL02184:Tpgs2 APN 18 25,273,630 (GRCm39) missense probably damaging 1.00
IGL02234:Tpgs2 APN 18 25,282,301 (GRCm39) critical splice acceptor site probably null
IGL02747:Tpgs2 APN 18 25,272,202 (GRCm39) intron probably benign
PIT4466001:Tpgs2 UTSW 18 25,301,652 (GRCm39) missense possibly damaging 0.77
PIT4472001:Tpgs2 UTSW 18 25,301,652 (GRCm39) missense possibly damaging 0.77
R0004:Tpgs2 UTSW 18 25,291,295 (GRCm39) splice site probably benign
R0139:Tpgs2 UTSW 18 25,282,242 (GRCm39) missense probably damaging 1.00
R0898:Tpgs2 UTSW 18 25,282,207 (GRCm39) missense probably damaging 1.00
R1415:Tpgs2 UTSW 18 25,301,610 (GRCm39) missense probably damaging 1.00
R1590:Tpgs2 UTSW 18 25,273,630 (GRCm39) missense probably damaging 1.00
R1974:Tpgs2 UTSW 18 25,273,593 (GRCm39) missense probably damaging 1.00
R2144:Tpgs2 UTSW 18 25,301,598 (GRCm39) missense possibly damaging 0.93
R4811:Tpgs2 UTSW 18 25,262,897 (GRCm39) intron probably benign
R4851:Tpgs2 UTSW 18 25,284,305 (GRCm39) missense possibly damaging 0.94
R6386:Tpgs2 UTSW 18 25,272,081 (GRCm39) missense possibly damaging 0.74
R6564:Tpgs2 UTSW 18 25,291,344 (GRCm39) missense probably damaging 0.99
R6788:Tpgs2 UTSW 18 25,262,927 (GRCm39) missense probably benign 0.04
R7112:Tpgs2 UTSW 18 25,282,194 (GRCm39) missense probably damaging 1.00
R8722:Tpgs2 UTSW 18 25,274,679 (GRCm39) missense probably benign 0.17
R8808:Tpgs2 UTSW 18 25,284,275 (GRCm39) missense probably damaging 1.00
R8818:Tpgs2 UTSW 18 25,291,365 (GRCm39) missense probably damaging 1.00
R9009:Tpgs2 UTSW 18 25,301,777 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACTCAGGCACAATATCAGTGG -3'
(R):5'- TTCCTCTGGAGAGCAAACTTGC -3'

Sequencing Primer
(F):5'- CCTGTAGGCTTGTAGAACTGTACATC -3'
(R):5'- TGCCCTCTTACATCAGCAGTAGAG -3'
Posted On 2019-12-03