Incidental Mutation 'R7825:Ambra1'
ID602112
Institutional Source Beutler Lab
Gene Symbol Ambra1
Ensembl Gene ENSMUSG00000040506
Gene Nameautophagy/beclin 1 regulator 1
Synonyms2310079H06Rik, D030051N19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R7825 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91730134-91918849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91767761 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 89 (H89R)
Ref Sequence ENSEMBL: ENSMUSP00000097299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]
Predicted Effect probably damaging
Transcript: ENSMUST00000045699
AA Change: H89R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: H89R

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000045705
AA Change: H89R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: H89R

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
Blast:WD40 932 970 1e-5 BLAST
Blast:WD40 991 1038 1e-7 BLAST
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1122 1146 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099712
AA Change: H89R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: H89R

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 613 N/A INTRINSIC
low complexity region 665 672 N/A INTRINSIC
Blast:WD40 841 879 1e-5 BLAST
Blast:WD40 900 947 1e-7 BLAST
low complexity region 971 983 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
low complexity region 1156 1172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111316
AA Change: H89R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506
AA Change: H89R

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
Blast:WD40 872 910 1e-5 BLAST
Blast:WD40 931 978 1e-7 BLAST
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1062 1086 N/A INTRINSIC
low complexity region 1187 1203 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111317
AA Change: H89R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: H89R

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Adprhl2 C A 4: 126,321,696 probably benign Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Clasp1 T C 1: 118,545,393 V3A probably benign Het
Cmya5 G T 13: 93,097,628 H317Q possibly damaging Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Eif3e A C 15: 43,266,271 probably null Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gnmt T C 17: 46,729,093 D20G probably damaging Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Kcnb1 A T 2: 167,105,972 S319T probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Nav1 A T 1: 135,450,044 V1689D probably damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Tmc1 T C 19: 20,804,645 I570V possibly damaging Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttc39d A G 17: 80,216,146 N78S probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Ambra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ambra1 APN 2 91911589 missense probably benign 0.01
IGL00861:Ambra1 APN 2 91770926 missense possibly damaging 0.81
IGL00911:Ambra1 APN 2 91767682 splice site probably benign
IGL01371:Ambra1 APN 2 91825286 missense probably damaging 1.00
IGL01532:Ambra1 APN 2 91885632 missense probably damaging 1.00
IGL01620:Ambra1 APN 2 91911412 critical splice acceptor site probably null
IGL02147:Ambra1 APN 2 91767719 missense probably benign 0.01
IGL02170:Ambra1 APN 2 91767087 missense possibly damaging 0.66
IGL02173:Ambra1 APN 2 91917668 missense probably benign
IGL02212:Ambra1 APN 2 91917361 missense probably damaging 1.00
IGL02256:Ambra1 APN 2 91769054 missense possibly damaging 0.95
IGL02319:Ambra1 APN 2 91886920 missense probably damaging 1.00
IGL02502:Ambra1 APN 2 91900532 missense probably damaging 1.00
IGL02961:Ambra1 APN 2 91911448 missense possibly damaging 0.86
R0003:Ambra1 UTSW 2 91911428 missense probably damaging 1.00
R0098:Ambra1 UTSW 2 91767711 missense possibly damaging 0.66
R0173:Ambra1 UTSW 2 91810219 splice site probably benign
R0414:Ambra1 UTSW 2 91875739 missense possibly damaging 0.84
R0579:Ambra1 UTSW 2 91824465 missense possibly damaging 0.66
R1212:Ambra1 UTSW 2 91769036 missense possibly damaging 0.94
R1241:Ambra1 UTSW 2 91770896 splice site probably benign
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1533:Ambra1 UTSW 2 91886865 missense probably damaging 1.00
R1916:Ambra1 UTSW 2 91911461 missense probably damaging 1.00
R2080:Ambra1 UTSW 2 91885719 missense probably damaging 1.00
R2083:Ambra1 UTSW 2 91766600 missense possibly damaging 0.83
R2112:Ambra1 UTSW 2 91875787 missense probably damaging 1.00
R2255:Ambra1 UTSW 2 91917461 missense probably damaging 1.00
R3407:Ambra1 UTSW 2 91910307 missense probably damaging 1.00
R3732:Ambra1 UTSW 2 91810131 missense probably damaging 1.00
R4111:Ambra1 UTSW 2 91900558 missense probably damaging 1.00
R4792:Ambra1 UTSW 2 91772846 missense possibly damaging 0.66
R4879:Ambra1 UTSW 2 91772694 intron probably benign
R5007:Ambra1 UTSW 2 91772310 missense possibly damaging 0.79
R5261:Ambra1 UTSW 2 91885606 missense probably damaging 1.00
R6141:Ambra1 UTSW 2 91875754 missense probably damaging 1.00
R6364:Ambra1 UTSW 2 91773316 missense possibly damaging 0.66
R6413:Ambra1 UTSW 2 91769084 missense possibly damaging 0.92
R6868:Ambra1 UTSW 2 91917533 missense possibly damaging 0.83
R6888:Ambra1 UTSW 2 91769027 missense probably damaging 1.00
R6964:Ambra1 UTSW 2 91917416 nonsense probably null
R6970:Ambra1 UTSW 2 91772600 intron probably benign
R6982:Ambra1 UTSW 2 91917473 missense probably damaging 1.00
R7205:Ambra1 UTSW 2 91767758 missense possibly damaging 0.46
R7458:Ambra1 UTSW 2 91917684 missense probably benign 0.26
R7786:Ambra1 UTSW 2 91767796 missense possibly damaging 0.46
R7812:Ambra1 UTSW 2 91766566 start codon destroyed probably benign 0.00
R7860:Ambra1 UTSW 2 91773493 missense probably benign 0.27
R8190:Ambra1 UTSW 2 91772352 missense possibly damaging 0.95
Z1177:Ambra1 UTSW 2 91768999 missense possibly damaging 0.81
Z1177:Ambra1 UTSW 2 91875786 missense probably damaging 0.97
Z1177:Ambra1 UTSW 2 91900608 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAGAGAAACTACCTAGTAGGCATACC -3'
(R):5'- CCAATGGCAAACAAGTCTCTG -3'

Sequencing Primer
(F):5'- TCATTTGTAGTGAGTAGTGTAGGG -3'
(R):5'- CTCTGTGTCTGGAATACCAAAGG -3'
Posted On2019-12-03