Incidental Mutation 'R7825:Polr1b'
ID602113
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7825 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129125544 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 952 (F952L)
Ref Sequence ENSEMBL: ENSMUSP00000099494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000035481] [ENSMUST00000103205]
Predicted Effect probably benign
Transcript: ENSMUST00000028874
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035481
SMART Domains Protein: ENSMUSP00000044253
Gene: ENSMUSG00000037938

DomainStartEndE-ValueType
PDB:2LQL|A 1 110 2e-69 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000103205
AA Change: F952L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395
AA Change: F952L

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Adprhl2 C A 4: 126,321,696 probably benign Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ambra1 A G 2: 91,767,761 H89R probably damaging Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Cmya5 G T 13: 93,097,628 H317Q possibly damaging Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gnmt T C 17: 46,729,093 D20G probably damaging Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Kcnb1 A T 2: 167,105,972 S319T probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Nav1 A T 1: 135,450,044 V1689D probably damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Nxf2 GGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCAT GGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCAT X: 134,951,973 probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Tmc1 T C 19: 20,804,645 I570V possibly damaging Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttc39d A G 17: 80,216,146 N78S probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
PIT4362001:Polr1b UTSW 2 129109292 missense possibly damaging 0.84
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R2414:Polr1b UTSW 2 129103134 splice site probably benign
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R3837:Polr1b UTSW 2 129119107 missense possibly damaging 0.78
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4773:Polr1b UTSW 2 129105328 missense probably benign 0.29
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5579:Polr1b UTSW 2 129110108 missense probably damaging 1.00
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6427:Polr1b UTSW 2 129123261 missense probably damaging 0.99
R6677:Polr1b UTSW 2 129120211 intron probably benign
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
R7376:Polr1b UTSW 2 129119073 missense probably benign 0.00
R7453:Polr1b UTSW 2 129125663 missense probably damaging 1.00
R7545:Polr1b UTSW 2 129117846 intron probably null
R7770:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7772:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7774:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7776:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7777:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7814:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7826:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7827:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7828:Polr1b UTSW 2 129105280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAAGTTTGCCAGCCGACATG -3'
(R):5'- CTGGCTCCAGTTGTTCTGAC -3'

Sequencing Primer
(F):5'- CGACATGGTCAGAAGGGCATTTTG -3'
(R):5'- CTGACTTGAAATTTGTCTGACACC -3'
Posted On2019-12-03