Incidental Mutation 'R7825:Kcnb1'
ID602115
Institutional Source Beutler Lab
Gene Symbol Kcnb1
Ensembl Gene ENSMUSG00000050556
Gene Namepotassium voltage gated channel, Shab-related subfamily, member 1
SynonymsKcr1-1, Shab, Kv2.1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7825 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location167095969-167190155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167105972 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 319 (S319T)
Ref Sequence ENSEMBL: ENSMUSP00000147093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059826] [ENSMUST00000207917]
Predicted Effect probably damaging
Transcript: ENSMUST00000059826
AA Change: S319T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057981
Gene: ENSMUSG00000050556
AA Change: S319T

DomainStartEndE-ValueType
BTB 31 140 1.3e-14 SMART
low complexity region 150 162 N/A INTRINSIC
Pfam:Ion_trans 188 424 2.4e-50 PFAM
Pfam:Ion_trans_2 332 418 1.2e-13 PFAM
Pfam:Kv2channel 467 618 5.4e-48 PFAM
low complexity region 698 706 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207917
AA Change: S319T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel and its activity is modulated by some other family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show reduced fasting glucose levels, hyperinsulinemia, improved glucose tolerance, altered glucose-induced electrical activity of pancreatic beta cells, and enhanced insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Adprhl2 C A 4: 126,321,696 probably benign Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ambra1 A G 2: 91,767,761 H89R probably damaging Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Cmya5 G T 13: 93,097,628 H317Q possibly damaging Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gnmt T C 17: 46,729,093 D20G probably damaging Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Nav1 A T 1: 135,450,044 V1689D probably damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Nxf2 GGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCAT GGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCAT X: 134,951,973 probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Tmc1 T C 19: 20,804,645 I570V possibly damaging Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttc39d A G 17: 80,216,146 N78S probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Kcnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Kcnb1 APN 2 167106207 missense probably damaging 1.00
IGL02945:Kcnb1 APN 2 167188388 missense probably benign 0.03
R0139:Kcnb1 UTSW 2 167105539 missense possibly damaging 0.94
R0144:Kcnb1 UTSW 2 167104547 missense probably damaging 1.00
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R0848:Kcnb1 UTSW 2 167106267 missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R3964:Kcnb1 UTSW 2 167104492 missense probably damaging 1.00
R3966:Kcnb1 UTSW 2 167104492 missense probably damaging 1.00
R4254:Kcnb1 UTSW 2 167105731 missense probably damaging 1.00
R4418:Kcnb1 UTSW 2 167105675 nonsense probably null
R4625:Kcnb1 UTSW 2 167188233 missense probably damaging 1.00
R4949:Kcnb1 UTSW 2 167105601 missense probably damaging 1.00
R5144:Kcnb1 UTSW 2 167105944 missense probably damaging 1.00
R5249:Kcnb1 UTSW 2 167105183 missense possibly damaging 0.95
R5849:Kcnb1 UTSW 2 167106026 missense probably damaging 1.00
R5869:Kcnb1 UTSW 2 167188071 missense probably benign 0.01
R6108:Kcnb1 UTSW 2 167105140 missense probably damaging 1.00
R6636:Kcnb1 UTSW 2 167105854 missense probably damaging 0.99
R6637:Kcnb1 UTSW 2 167105854 missense probably damaging 0.99
R6880:Kcnb1 UTSW 2 167105807 missense probably damaging 1.00
R7391:Kcnb1 UTSW 2 167105450 missense probably damaging 1.00
R7401:Kcnb1 UTSW 2 167188284 missense probably damaging 0.99
R7651:Kcnb1 UTSW 2 167188361 missense probably damaging 1.00
R7744:Kcnb1 UTSW 2 167188331 missense probably damaging 1.00
R7848:Kcnb1 UTSW 2 167106268 missense probably damaging 1.00
R7931:Kcnb1 UTSW 2 167106268 missense probably damaging 1.00
Z1088:Kcnb1 UTSW 2 167188061 missense probably benign 0.38
Z1176:Kcnb1 UTSW 2 167188402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGTCGTCATGGTGATG -3'
(R):5'- ACTTGCTGAGGTTCCTGTCC -3'

Sequencing Primer
(F):5'- TCATGGTGATGGTAGCCCAC -3'
(R):5'- AATGGAAGTTCTTTAAGGGCCCCC -3'
Posted On2019-12-03