Incidental Mutation 'R7825:Adprhl2'
ID 602120
Institutional Source Beutler Lab
Gene Symbol Adprhl2
Ensembl Gene ENSMUSG00000042558
Gene Name ADP-ribosylhydrolase like 2
Synonyms Arh3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7825 (G1)
Quality Score 194.009
Status Validated
Chromosome 4
Chromosomal Location 126316047-126321703 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 126321696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000102616] [ENSMUST00000102617] [ENSMUST00000131113] [ENSMUST00000141990]
AlphaFold Q8CG72
Predicted Effect probably benign
Transcript: ENSMUST00000030658
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102616
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102617
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131113
SMART Domains Protein: ENSMUSP00000116659
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 126 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141990
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADP-ribosylglycohydrolase family. The encoded enzyme catalyzes the removal of ADP-ribose from ADP-ribosylated proteins. This enzyme localizes to the mitochondria, in addition to the nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ambra1 A G 2: 91,767,761 H89R probably damaging Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Clasp1 T C 1: 118,545,393 V3A probably benign Het
Cmya5 G T 13: 93,097,628 H317Q possibly damaging Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Eif3e A C 15: 43,266,271 probably null Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gnmt T C 17: 46,729,093 D20G probably damaging Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Kcnb1 A T 2: 167,105,972 S319T probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Nav1 A T 1: 135,450,044 V1689D probably damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Tmc1 T C 19: 20,804,645 I570V possibly damaging Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttc39d A G 17: 80,216,146 N78S probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Adprhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Adprhl2 APN 4 126318481 missense probably damaging 1.00
IGL02391:Adprhl2 APN 4 126317908 splice site probably benign
IGL03189:Adprhl2 APN 4 126317294 splice site probably benign
R0139:Adprhl2 UTSW 4 126318154 missense probably damaging 1.00
R0302:Adprhl2 UTSW 4 126317392 missense probably benign 0.00
R0879:Adprhl2 UTSW 4 126316617 missense probably benign
R2008:Adprhl2 UTSW 4 126317344 missense probably benign 0.05
R3789:Adprhl2 UTSW 4 126316751 missense probably damaging 0.96
R5038:Adprhl2 UTSW 4 126317309 missense possibly damaging 0.69
R5058:Adprhl2 UTSW 4 126318445 missense probably damaging 1.00
R5724:Adprhl2 UTSW 4 126318076 missense probably damaging 1.00
R6171:Adprhl2 UTSW 4 126317317 missense probably damaging 1.00
R6326:Adprhl2 UTSW 4 126316613 missense possibly damaging 0.58
R8552:Adprhl2 UTSW 4 126316575 makesense probably null
R9008:Adprhl2 UTSW 4 126316839 missense probably damaging 1.00
R9142:Adprhl2 UTSW 4 126321567 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321567 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321661 missense unknown
Predicted Primers PCR Primer
(F):5'- GACGTGACTCAGGACTGATG -3'
(R):5'- CGCATTTGTGGTGCCATTTAC -3'

Sequencing Primer
(F):5'- TGACTCAGGACTGATGCCAGG -3'
(R):5'- TGTGGTGCCATTTACAAATGAG -3'
Posted On 2019-12-03