Incidental Mutation 'R7825:Cyp2f2'
ID602134
Institutional Source Beutler Lab
Gene Symbol Cyp2f2
Ensembl Gene ENSMUSG00000052974
Gene Namecytochrome P450, family 2, subfamily f, polypeptide 2
SynonymsCyp2f
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7825 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27119909-27133660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27129253 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 183 (V183I)
Ref Sequence ENSEMBL: ENSMUSP00000003100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003100] [ENSMUST00000206552]
Predicted Effect probably benign
Transcript: ENSMUST00000003100
AA Change: V183I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003100
Gene: ENSMUSG00000052974
AA Change: V183I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:p450 31 488 3.7e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206552
AA Change: V107I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to dehydrogenate 3-methylindole, an endogenous toxin derived from the fermentation of tryptophan, as well as xenobiotic substrates such as naphthalene and ethoxycoumarin. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to napthalene-induced toxicity in the lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Adprhl2 C A 4: 126,321,696 probably benign Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ambra1 A G 2: 91,767,761 H89R probably damaging Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Cmya5 G T 13: 93,097,628 H317Q possibly damaging Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gnmt T C 17: 46,729,093 D20G probably damaging Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Kcnb1 A T 2: 167,105,972 S319T probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Nav1 A T 1: 135,450,044 V1689D probably damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Nxf2 GGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCAT GGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCAT X: 134,951,973 probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Tmc1 T C 19: 20,804,645 I570V possibly damaging Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttc39d A G 17: 80,216,146 N78S probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Cyp2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Cyp2f2 APN 7 27121929 missense probably damaging 0.98
IGL00953:Cyp2f2 APN 7 27129817 missense possibly damaging 0.47
IGL01781:Cyp2f2 APN 7 27130421 missense probably benign 0.20
IGL02817:Cyp2f2 APN 7 27129315 missense probably damaging 1.00
IGL03027:Cyp2f2 APN 7 27132571 missense possibly damaging 0.95
R0464:Cyp2f2 UTSW 7 27132537 missense probably benign 0.00
R1481:Cyp2f2 UTSW 7 27121877 missense probably benign 0.00
R1635:Cyp2f2 UTSW 7 27129724 missense probably benign 0.11
R1826:Cyp2f2 UTSW 7 27132562 missense probably damaging 1.00
R1989:Cyp2f2 UTSW 7 27129203 missense probably damaging 1.00
R5098:Cyp2f2 UTSW 7 27129879 missense possibly damaging 0.52
R6305:Cyp2f2 UTSW 7 27129224 missense probably damaging 1.00
R6472:Cyp2f2 UTSW 7 27129224 missense probably damaging 1.00
R7132:Cyp2f2 UTSW 7 27132568 missense probably benign 0.00
R7599:Cyp2f2 UTSW 7 27131359 critical splice donor site probably null
R7814:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7823:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
R7824:Cyp2f2 UTSW 7 27129253 missense probably benign 0.00
X0064:Cyp2f2 UTSW 7 27133284 missense probably damaging 1.00
Z1177:Cyp2f2 UTSW 7 27121907 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AGAGCATTCTGGACTGTGAGG -3'
(R):5'- ATGGGTGGACCGTGTAACTG -3'

Sequencing Primer
(F):5'- AGGTGCTGTCTCACGGTG -3'
(R):5'- TCAGGAACTTGTGGCAATCC -3'
Posted On2019-12-03