Incidental Mutation 'R7825:Cmya5'
ID602145
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R7825 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 93097628 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 317 (H317Q)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062122
AA Change: H317Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: H317Q

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Adprhl2 C A 4: 126,321,696 probably benign Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ambra1 A G 2: 91,767,761 H89R probably damaging Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Clasp1 T C 1: 118,545,393 V3A probably benign Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Eif3e A C 15: 43,266,271 probably null Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gnmt T C 17: 46,729,093 D20G probably damaging Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Kcnb1 A T 2: 167,105,972 S319T probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Nav1 A T 1: 135,450,044 V1689D probably damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Tmc1 T C 19: 20,804,645 I570V possibly damaging Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttc39d A G 17: 80,216,146 N78S probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense probably benign 0.00
R7088:Cmya5 UTSW 13 93091864 missense possibly damaging 0.95
R7126:Cmya5 UTSW 13 93089940 missense probably benign 0.41
R7177:Cmya5 UTSW 13 93095328 missense probably benign 0.00
R7188:Cmya5 UTSW 13 93046038 missense probably damaging 1.00
R7217:Cmya5 UTSW 13 93090430 missense probably damaging 1.00
R7278:Cmya5 UTSW 13 93095700 missense probably damaging 0.96
R7293:Cmya5 UTSW 13 93092797 missense possibly damaging 0.90
R7332:Cmya5 UTSW 13 93092553 missense possibly damaging 0.60
R7375:Cmya5 UTSW 13 93091661 missense probably damaging 0.97
R7386:Cmya5 UTSW 13 93069323 missense probably damaging 1.00
R7489:Cmya5 UTSW 13 93091838 missense possibly damaging 0.87
R7529:Cmya5 UTSW 13 93097434 missense probably benign 0.02
R7552:Cmya5 UTSW 13 93069312 missense probably benign 0.41
R7624:Cmya5 UTSW 13 93090357 missense possibly damaging 0.79
R7637:Cmya5 UTSW 13 93083212 missense possibly damaging 0.87
R7673:Cmya5 UTSW 13 93094121 missense probably benign 0.13
R7753:Cmya5 UTSW 13 93098172 missense probably benign 0.18
R7757:Cmya5 UTSW 13 93098272 missense possibly damaging 0.53
R7806:Cmya5 UTSW 13 93094262 missense probably benign 0.00
R7878:Cmya5 UTSW 13 93089757 missense probably damaging 0.98
R7892:Cmya5 UTSW 13 93096357 missense probably damaging 0.96
R7952:Cmya5 UTSW 13 93097004 small deletion probably benign
R8127:Cmya5 UTSW 13 93094614 missense probably damaging 0.99
R8256:Cmya5 UTSW 13 93093478 missense possibly damaging 0.62
R8339:Cmya5 UTSW 13 93091634 nonsense probably null
R8446:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
RF020:Cmya5 UTSW 13 93069291 missense possibly damaging 0.56
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93063579 missense probably benign
Z1176:Cmya5 UTSW 13 93096790 missense unknown
Z1177:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAATGCTTGGTGGCTCCATTC -3'
(R):5'- TATGGGACGTTGCCAAAAGGTTATG -3'

Sequencing Primer
(F):5'- CTGTGGGTCTTTGATTCATCAGC -3'
(R):5'- CGTTGCCAAAAGGTTATGTAATTAAG -3'
Posted On2019-12-03