Mutagenetix > Incidental Mutations

Incidental Mutation 'R7825:Krt76'

602150

Institutional Source

Beutler Lab

Gene Symbol

Krt76

Ensembl Gene

ENSMUSG00000075402

Gene Name

keratin 76

Synonyms

2310001L23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7825 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101884351-101892920 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101887503 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 411 (T411S)

Ref Sequence

ENSEMBL: ENSMUSP00000097754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100179]

AlphaFold

Q3UV17

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100179
AA Change: T411S

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: T411S

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	161	5.7e-39	PFAM
Filament	164	479	2.12e-166	SMART
low complexity region	488	551	N/A	INTRINSIC
low complexity region	565	593	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	C	T	4: 137,455,343	R270C	probably damaging	Het
Adprhl2	C	A	4: 126,321,696		probably benign	Het
Akp3	TCACCACCACCACCACCACCACCACCACCAC	TCACCACCACCACCACCACCACCACCAC	1: 87,127,767		probably benign	Het
Ambra1	A	G	2: 91,767,761	H89R	probably damaging	Het
Atp1a1	T	C	3: 101,586,169	N540D	probably benign	Het
Cd38	A	T	5: 43,901,455	H137L	probably damaging	Het
Clasp1	T	C	1: 118,545,393	V3A	probably benign	Het
Cmya5	G	T	13: 93,097,628	H317Q	possibly damaging	Het
Cpeb2	A	T	5: 43,237,539	D95V	probably damaging	Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Dcst1	A	G	3: 89,352,821	L572P	possibly damaging	Het
Eif3e	A	C	15: 43,266,271		probably null	Het
Ephb4	T	C	5: 137,372,437	S911P	probably damaging	Het
Fam186b	T	C	15: 99,283,847	T157A	not run	Het
Gnmt	T	C	17: 46,729,093	D20G	probably damaging	Het
Gpatch8	A	C	11: 102,481,442	D423E	unknown	Het
Gtf3c2	T	C	5: 31,158,371	H790R	probably damaging	Het
Hepacam	T	C	9: 37,384,768	I405T	probably benign	Het
Hspg2	T	A	4: 137,558,849	V3574E	probably damaging	Het
Ifi202b	A	C	1: 173,975,050	F73V	probably damaging	Het
Kcnb1	A	T	2: 167,105,972	S319T	probably damaging	Het
Krt16	T	A	11: 100,248,634	D86V	unknown	Het
Myh8	A	T	11: 67,303,712	D1583V	possibly damaging	Het
Nav1	A	T	1: 135,450,044	V1689D	probably damaging	Het
Ncor2	T	C	5: 125,037,077	T611A	possibly damaging	Het
Nipbl	T	A	15: 8,291,487	Y2712F	probably damaging	Het
Ntng2	T	A	2: 29,204,078	H427L	probably benign	Het
Pcdhga4	T	A	18: 37,687,321	L641Q	probably damaging	Het
Phc1	T	C	6: 122,322,381	K623R	probably benign	Het
Polr1b	C	A	2: 129,125,544	F952L	probably damaging	Het
Prcc	T	A	3: 87,869,745	E307D	possibly damaging	Het
Prss27	T	C	17: 24,042,958	F80S	probably damaging	Het
Rsf1	G	GACGGCGGCC	7: 97,579,909		probably benign	Het
Serpina11	T	C	12: 103,984,577	Q295R	probably benign	Het
Sgk2	G	T	2: 163,006,881	V284L	possibly damaging	Het
Slc15a2	C	T	16: 36,753,034	V603I	possibly damaging	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Stat1	A	G	1: 52,151,308	H574R	probably damaging	Het
Ston1	T	C	17: 88,636,453	V429A	possibly damaging	Het
Tep1	T	C	14: 50,843,887		probably null	Het
Tesk1	A	C	4: 43,447,143	R510S	probably damaging	Het
Themis	A	G	10: 28,782,474	E499G	probably benign	Het
Thra	G	A	11: 98,762,948	V202I	probably benign	Het
Tiam1	A	T	16: 89,898,089	M160K	probably benign	Het
Tmc1	T	C	19: 20,804,645	I570V	possibly damaging	Het
Treml1	C	A	17: 48,366,756	P270Q	probably damaging	Het
Ttc39d	A	G	17: 80,216,146	N78S	probably damaging	Het
Ttll3	CAAAGTAA	CAAAGTAAAGTAA	6: 113,399,157		probably null	Het
Ttll3	AAGTA	AAGTAGAGTA	6: 113,399,159		probably null	Het
Ube3b	T	A	5: 114,401,312	L388Q	probably damaging	Het
Ugt2b35	T	A	5: 87,001,359	C156*	probably null	Het
Vmn1r35	A	T	6: 66,679,459	C76S	probably damaging	Het
Wwc2	A	G	8: 47,990,162	L12P	probably damaging	Het
Zfat	T	C	15: 68,179,920	E668G	probably benign	Het
Zfp40	T	C	17: 23,176,327	T429A	probably benign	Het

Other mutations in Krt76

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Krt76	APN	15	101884888	missense	unknown
IGL01475:Krt76	APN	15	101888513	missense	probably benign	0.11
IGL01504:Krt76	APN	15	101888173	missense	probably damaging	1.00
IGL01506:Krt76	APN	15	101892400	missense	probably damaging	0.97
IGL01943:Krt76	APN	15	101889045	missense	probably null	0.98
IGL03164:Krt76	APN	15	101887451	missense	possibly damaging	0.50
PIT4378001:Krt76	UTSW	15	101892407	missense	probably damaging	0.99
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0448:Krt76	UTSW	15	101890647	missense	probably damaging	1.00
R0730:Krt76	UTSW	15	101887349	missense	probably damaging	1.00
R0920:Krt76	UTSW	15	101892439	missense	possibly damaging	0.80
R1568:Krt76	UTSW	15	101885008	missense	unknown
R1779:Krt76	UTSW	15	101892687	missense	unknown
R1869:Krt76	UTSW	15	101889487	critical splice donor site	probably null
R1911:Krt76	UTSW	15	101888165	nonsense	probably null
R2160:Krt76	UTSW	15	101888385	missense	probably damaging	1.00
R2504:Krt76	UTSW	15	101884858	missense	unknown
R4487:Krt76	UTSW	15	101890482	missense	possibly damaging	0.71
R4729:Krt76	UTSW	15	101889081	missense	probably damaging	1.00
R4747:Krt76	UTSW	15	101885745	missense	probably damaging	1.00
R4912:Krt76	UTSW	15	101888162	nonsense	probably null
R5357:Krt76	UTSW	15	101887385	missense	probably benign	0.04
R6738:Krt76	UTSW	15	101887478	missense	probably benign	0.40
R7786:Krt76	UTSW	15	101890530	missense	probably damaging	0.98
R7808:Krt76	UTSW	15	101890494	missense	probably damaging	1.00
R8079:Krt76	UTSW	15	101888390	missense	possibly damaging	0.61
R8846:Krt76	UTSW	15	101887337	missense	probably damaging	1.00
R8980:Krt76	UTSW	15	101892555	missense	unknown
Z1088:Krt76	UTSW	15	101890551	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACTTGGAGAATGCTGACCC -3'
(R):5'- GACTCAGGATGAATTAGCCAAATTGC -3'

Sequencing Primer
(F):5'- TTGGAGAATGCTGACCCCCAAG -3'
(R):5'- TGCAACATCAACCTGACTTGTG -3'

Posted On

2019-12-03