Incidental Mutation 'R7825:Gnmt'
ID602155
Institutional Source Beutler Lab
Gene Symbol Gnmt
Ensembl Gene ENSMUSG00000002769
Gene Nameglycine N-methyltransferase
Synonymsglycine N methyl transferase
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R7825 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46725664-46729168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46729093 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 20 (D20G)
Ref Sequence ENSEMBL: ENSMUSP00000002846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002840] [ENSMUST00000002846]
PDB Structure
Crystal Structure of Mouse Glycine N-Methyltransferase (Tetragonal Form) [X-RAY DIFFRACTION]
Crystal Structure of Mouse Glycine N-Methyltransferase (Monoclinic Form) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002840
SMART Domains Protein: ENSMUSP00000002840
Gene: ENSMUSG00000002763

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 112 128 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
AAA 463 598 6.1e-7 SMART
AAA 737 875 6e-24 SMART
Blast:AAA 928 973 1e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000002846
AA Change: D20G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002846
Gene: ENSMUSG00000002769
AA Change: D20G

DomainStartEndE-ValueType
Pfam:Methyltransf_23 27 217 9e-11 PFAM
Pfam:Methyltransf_31 56 224 1.3e-15 PFAM
Pfam:Methyltransf_18 57 176 1.5e-15 PFAM
Pfam:Methyltransf_25 61 169 1.4e-10 PFAM
Pfam:Methyltransf_12 62 171 4e-12 PFAM
Pfam:Methyltransf_11 62 173 2.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the conversion of S-adenosyl-L-methionine (along with glycine) to S-adenosyl-L-homocysteine and sarcosine. This protein is found in the cytoplasm and acts as a homotetramer. Defects in this gene are a cause of GNMT deficiency (hypermethioninemia). Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between the upstream CNPY3 (canopy FGF signaling regulator 3) gene and this gene and is represented with GeneID:107080644. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null mutation display elevated levels of methionine and S-adenosylmethionine in the liver. Mice homozygous for another null allele exhibit hepatitis, increased hepatic glycogen storage, and hepatocellular carcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Adprhl2 C A 4: 126,321,696 probably benign Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ambra1 A G 2: 91,767,761 H89R probably damaging Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Cmya5 G T 13: 93,097,628 H317Q possibly damaging Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Kcnb1 A T 2: 167,105,972 S319T probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Nav1 A T 1: 135,450,044 V1689D probably damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Nxf2 GGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCAT GGTCCTTGCCATCCTGAGGATTTCCTGTCGGTACTATTAAGTCCTTGCCAT X: 134,951,973 probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Tmc1 T C 19: 20,804,645 I570V possibly damaging Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttc39d A G 17: 80,216,146 N78S probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Gnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Gnmt APN 17 46726680 missense probably benign 0.28
health_nut UTSW 17 46726345 missense probably damaging 1.00
impulsive UTSW 17 46725966 missense probably damaging 1.00
rash UTSW 17 46725736 utr 3 prime probably benign
R0480:Gnmt UTSW 17 46725928 missense probably benign 0.06
R0938:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0939:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0940:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R0941:Gnmt UTSW 17 46726345 missense probably damaging 1.00
R3619:Gnmt UTSW 17 46729037 missense possibly damaging 0.63
R4173:Gnmt UTSW 17 46726121 missense probably damaging 1.00
R4456:Gnmt UTSW 17 46728984 missense probably benign 0.07
R4498:Gnmt UTSW 17 46725736 utr 3 prime probably benign
R4659:Gnmt UTSW 17 46725966 missense probably damaging 1.00
R4669:Gnmt UTSW 17 46726299 nonsense probably null
R4827:Gnmt UTSW 17 46727319 missense possibly damaging 0.77
R5112:Gnmt UTSW 17 46726330 missense probably damaging 1.00
R5133:Gnmt UTSW 17 46725934 missense probably benign
R5797:Gnmt UTSW 17 46726379 missense probably damaging 1.00
R7423:Gnmt UTSW 17 46726140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACCCTGATGAGCAAGGG -3'
(R):5'- TCCAGGATTGCTGTGCTGAG -3'

Sequencing Primer
(F):5'- AGGGCTCTTGACCCCCTAGTAC -3'
(R):5'- GATTGCTGTGCTGAGCCATCC -3'
Posted On2019-12-03