Incidental Mutation 'R7825:Ttc39d'
ID602157
Institutional Source Beutler Lab
Gene Symbol Ttc39d
Ensembl Gene ENSMUSG00000046196
Gene Nametetratricopeptide repeat domain 39D
Synonyms4930560E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7825 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location80207460-80217936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80216146 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 78 (N78S)
Ref Sequence ENSEMBL: ENSMUSP00000123158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053168] [ENSMUST00000134652]
Predicted Effect probably damaging
Transcript: ENSMUST00000053168
AA Change: N78S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053781
Gene: ENSMUSG00000046196
AA Change: N78S

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 9.6e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134652
AA Change: N78S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123158
Gene: ENSMUSG00000046196
AA Change: N78S

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 7.2e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Adprhl2 C A 4: 126,321,696 probably benign Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ambra1 A G 2: 91,767,761 H89R probably damaging Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Clasp1 T C 1: 118,545,393 V3A probably benign Het
Cmya5 G T 13: 93,097,628 H317Q possibly damaging Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Eif3e A C 15: 43,266,271 probably null Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gnmt T C 17: 46,729,093 D20G probably damaging Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Kcnb1 A T 2: 167,105,972 S319T probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Nav1 A T 1: 135,450,044 V1689D probably damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Tmc1 T C 19: 20,804,645 I570V possibly damaging Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Ttc39d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Ttc39d APN 17 80216526 missense probably damaging 0.99
IGL01065:Ttc39d APN 17 80216274 missense probably damaging 0.96
IGL01834:Ttc39d APN 17 80216046 missense probably benign
IGL02541:Ttc39d APN 17 80216446 missense probably damaging 0.99
PIT4687001:Ttc39d UTSW 17 80216925 missense probably damaging 1.00
R0042:Ttc39d UTSW 17 80215950 missense probably benign 0.02
R0042:Ttc39d UTSW 17 80215950 missense probably benign 0.02
R0124:Ttc39d UTSW 17 80216946 missense probably damaging 1.00
R0523:Ttc39d UTSW 17 80216457 missense possibly damaging 0.78
R0801:Ttc39d UTSW 17 80216215 missense probably damaging 1.00
R1581:Ttc39d UTSW 17 80216484 missense probably benign 0.02
R2071:Ttc39d UTSW 17 80216601 missense probably damaging 1.00
R2271:Ttc39d UTSW 17 80217246 missense probably damaging 1.00
R2272:Ttc39d UTSW 17 80217246 missense probably damaging 1.00
R2520:Ttc39d UTSW 17 80216370 missense probably benign 0.17
R2885:Ttc39d UTSW 17 80216715 missense probably benign 0.00
R2939:Ttc39d UTSW 17 80217553 missense probably damaging 1.00
R2940:Ttc39d UTSW 17 80217553 missense probably damaging 1.00
R3081:Ttc39d UTSW 17 80217553 missense probably damaging 1.00
R4669:Ttc39d UTSW 17 80217639 missense probably benign 0.00
R4872:Ttc39d UTSW 17 80217098 missense probably benign 0.00
R4951:Ttc39d UTSW 17 80216033 missense probably benign 0.01
R6260:Ttc39d UTSW 17 80216647 nonsense probably null
R7018:Ttc39d UTSW 17 80216181 missense probably benign 0.06
R7042:Ttc39d UTSW 17 80216462 missense probably benign 0.00
R7468:Ttc39d UTSW 17 80216150 missense possibly damaging 0.96
R7761:Ttc39d UTSW 17 80217312 missense probably damaging 0.98
R7955:Ttc39d UTSW 17 80215923 missense probably benign
R8192:Ttc39d UTSW 17 80216578 missense probably damaging 0.99
R8400:Ttc39d UTSW 17 80216005 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCTGAGTGAAGGCGAGCATG -3'
(R):5'- TCCCTGTCTACTCATTAGGCGAG -3'

Sequencing Primer
(F):5'- GCATGATAGAATGGTGAGAGTAAC -3'
(R):5'- CGAGATAAAGTCACTATCCTGGGC -3'
Posted On2019-12-03