Incidental Mutation 'R7825:Tmc1'
ID 602160
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Name transmembrane channel-like gene family 1
Synonyms 4933416G09Rik, Beethoven, Bth
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R7825 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 20783458-20954202 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20804645 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 570 (I570V)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
AlphaFold Q8R4P5
Predicted Effect possibly damaging
Transcript: ENSMUST00000039500
AA Change: I570V

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: I570V

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,455,343 R270C probably damaging Het
Adprhl2 C A 4: 126,321,696 probably benign Het
Akp3 TCACCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCACCAC 1: 87,127,767 probably benign Het
Ambra1 A G 2: 91,767,761 H89R probably damaging Het
Atp1a1 T C 3: 101,586,169 N540D probably benign Het
Cd38 A T 5: 43,901,455 H137L probably damaging Het
Clasp1 T C 1: 118,545,393 V3A probably benign Het
Cmya5 G T 13: 93,097,628 H317Q possibly damaging Het
Cpeb2 A T 5: 43,237,539 D95V probably damaging Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Dcst1 A G 3: 89,352,821 L572P possibly damaging Het
Eif3e A C 15: 43,266,271 probably null Het
Ephb4 T C 5: 137,372,437 S911P probably damaging Het
Fam186b T C 15: 99,283,847 T157A not run Het
Gnmt T C 17: 46,729,093 D20G probably damaging Het
Gpatch8 A C 11: 102,481,442 D423E unknown Het
Gtf3c2 T C 5: 31,158,371 H790R probably damaging Het
Hepacam T C 9: 37,384,768 I405T probably benign Het
Hspg2 T A 4: 137,558,849 V3574E probably damaging Het
Ifi202b A C 1: 173,975,050 F73V probably damaging Het
Kcnb1 A T 2: 167,105,972 S319T probably damaging Het
Krt16 T A 11: 100,248,634 D86V unknown Het
Krt76 T A 15: 101,887,503 T411S possibly damaging Het
Myh8 A T 11: 67,303,712 D1583V possibly damaging Het
Nav1 A T 1: 135,450,044 V1689D probably damaging Het
Ncor2 T C 5: 125,037,077 T611A possibly damaging Het
Nipbl T A 15: 8,291,487 Y2712F probably damaging Het
Ntng2 T A 2: 29,204,078 H427L probably benign Het
Pcdhga4 T A 18: 37,687,321 L641Q probably damaging Het
Phc1 T C 6: 122,322,381 K623R probably benign Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Prcc T A 3: 87,869,745 E307D possibly damaging Het
Prss27 T C 17: 24,042,958 F80S probably damaging Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Serpina11 T C 12: 103,984,577 Q295R probably benign Het
Sgk2 G T 2: 163,006,881 V284L possibly damaging Het
Slc15a2 C T 16: 36,753,034 V603I possibly damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Stat1 A G 1: 52,151,308 H574R probably damaging Het
Ston1 T C 17: 88,636,453 V429A possibly damaging Het
Tep1 T C 14: 50,843,887 probably null Het
Tesk1 A C 4: 43,447,143 R510S probably damaging Het
Themis A G 10: 28,782,474 E499G probably benign Het
Thra G A 11: 98,762,948 V202I probably benign Het
Tiam1 A T 16: 89,898,089 M160K probably benign Het
Treml1 C A 17: 48,366,756 P270Q probably damaging Het
Ttc39d A G 17: 80,216,146 N78S probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ube3b T A 5: 114,401,312 L388Q probably damaging Het
Ugt2b35 T A 5: 87,001,359 C156* probably null Het
Vmn1r35 A T 6: 66,679,459 C76S probably damaging Het
Wwc2 A G 8: 47,990,162 L12P probably damaging Het
Zfat T C 15: 68,179,920 E668G probably benign Het
Zfp40 T C 17: 23,176,327 T429A probably benign Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
dinner_bell UTSW 19 20795516 missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20824030 missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20789590 missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20827651 critical splice donor site probably null
R6796:Tmc1 UTSW 19 20799036 missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20799178 missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20907008 missense probably damaging 0.98
R8024:Tmc1 UTSW 19 20900817 missense probably damaging 1.00
R8073:Tmc1 UTSW 19 20868361 missense probably benign 0.08
R8786:Tmc1 UTSW 19 20826589 missense probably damaging 1.00
R8791:Tmc1 UTSW 19 20789845 missense probably benign 0.00
R8969:Tmc1 UTSW 19 20816229 missense probably damaging 1.00
R8973:Tmc1 UTSW 19 20900851 missense probably benign
R9429:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
Z1176:Tmc1 UTSW 19 20826506 missense probably null 1.00
Z1177:Tmc1 UTSW 19 20795608 missense possibly damaging 0.47
Z1177:Tmc1 UTSW 19 20823982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATACCATCTATCGGTACCTCAG -3'
(R):5'- ATTTTACCAGCTCCGTGACTG -3'

Sequencing Primer
(F):5'- TCGGTACCTCAGAAAATAAAGAACTG -3'
(R):5'- CCGTGACTGGCTTCTAACATGAG -3'
Posted On 2019-12-03