Incidental Mutation 'R7826:Igsf9'
ID602164
Institutional Source Beutler Lab
Gene Symbol Igsf9
Ensembl Gene ENSMUSG00000037995
Gene Nameimmunoglobulin superfamily, member 9
SynonymsNRT1, Dasm1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7826 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172481788-172498878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172491630 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 230 (V230A)
Ref Sequence ENSEMBL: ENSMUSP00000106866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052629] [ENSMUST00000111235] [ENSMUST00000127052] [ENSMUST00000127482] [ENSMUST00000135267]
Predicted Effect probably benign
Transcript: ENSMUST00000052629
AA Change: V230A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000058275
Gene: ENSMUSG00000037995
AA Change: V230A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111235
AA Change: V230A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000106866
Gene: ENSMUSG00000037995
AA Change: V230A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
FN3 508 593 1.82e-4 SMART
FN3 624 705 7.01e-6 SMART
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
low complexity region 909 930 N/A INTRINSIC
low complexity region 942 953 N/A INTRINSIC
low complexity region 1143 1165 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127052
SMART Domains Protein: ENSMUSP00000123401
Gene: ENSMUSG00000037995

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 26 109 6e-55 BLAST
SCOP:d1biha2 28 108 6e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127482
AA Change: V230A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117854
Gene: ENSMUSG00000037995
AA Change: V230A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 26 131 6.81e-6 SMART
IGc2 149 213 4.92e-12 SMART
IG 233 320 8.64e-8 SMART
IG_like 329 412 4.3e1 SMART
IGc2 431 493 9.12e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000135267
AA Change: V165A
SMART Domains Protein: ENSMUSP00000116948
Gene: ENSMUSG00000037995
AA Change: V165A

DomainStartEndE-ValueType
IG_like 4 68 3.29e1 SMART
IGc2 86 148 3.03e-12 SMART
low complexity region 156 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193620
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but show abnormal miniature inhibitory postsynaptic currents and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap27 T C 11: 103,338,327 T521A probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Btbd9 A T 17: 30,334,327 I387N probably benign Het
Ccdc27 C T 4: 154,039,501 probably null Het
Ccdc88a A T 11: 29,503,563 H1642L probably benign Het
Cd300c2 C T 11: 115,000,818 V77I possibly damaging Het
Chrnb2 A T 3: 89,763,243 S63T probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah5 C T 15: 28,367,812 T2781M probably damaging Het
Donson T C 16: 91,688,456 D86G possibly damaging Het
Echs1 T A 7: 140,116,436 probably benign Het
Epha8 C T 4: 136,936,187 M483I probably benign Het
Eprs T G 1: 185,406,968 V850G probably damaging Het
Fbxw5 C A 2: 25,502,549 C114* probably null Het
Gm5160 C T 18: 14,425,072 R69C probably benign Het
Gm996 C A 2: 25,578,465 R478L possibly damaging Het
Gpr75 A G 11: 30,891,209 H38R probably damaging Het
Lonp2 C T 8: 86,709,013 P626S probably damaging Het
Lrrtm1 G T 6: 77,244,112 probably null Het
Man1a2 T C 3: 100,582,139 E508G probably damaging Het
Mipep C A 14: 60,802,131 A203E probably damaging Het
Mrc1 T A 2: 14,294,857 C753S probably damaging Het
Mthfr A G 4: 148,055,010 E568G probably benign Het
Naca T A 10: 128,043,610 probably benign Het
Nek10 G A 14: 14,860,846 probably null Het
Nf2 T C 11: 4,789,750 T419A probably benign Het
Npas3 A G 12: 53,831,756 T164A possibly damaging Het
Nudcd3 T A 11: 6,150,581 I124F possibly damaging Het
Olfr952 A G 9: 39,426,127 *315Q probably null Het
Pappa2 A T 1: 158,936,440 C500* probably null Het
Pcdhb18 T A 18: 37,490,942 S442T probably damaging Het
Phactr4 T C 4: 132,378,441 N105D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Pzp T C 6: 128,487,533 T1344A probably benign Het
Ranbp9 T C 13: 43,419,621 I312V possibly damaging Het
Rsf1 A G 7: 97,661,161 probably benign Het
Slc6a4 A T 11: 77,013,025 I150L probably benign Het
Smpd5 T C 15: 76,296,296 S433P probably benign Het
Spats1 C T 17: 45,452,718 D209N probably damaging Het
Spcs2 C T 7: 99,839,777 G235R probably damaging Het
Sptlc3 T C 2: 139,547,195 M165T probably benign Het
Synm T C 7: 67,735,589 D775G probably damaging Het
Tango6 A G 8: 106,692,613 D264G probably benign Het
Tbc1d30 A T 10: 121,296,805 L218H probably damaging Het
Tmem132d A G 5: 127,789,889 I649T probably damaging Het
Tmem145 T C 7: 25,307,514 Y114H probably damaging Het
Triml1 A T 8: 43,138,766 V185E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,884,876 probably benign Het
Utrn C T 10: 12,401,306 probably null Het
Uty T C Y: 1,137,716 K887E possibly damaging Het
Zfand2b T C 1: 75,168,858 F3L possibly damaging Het
Zfp280d C A 9: 72,312,671 Q243K possibly damaging Het
Zfp418 T C 7: 7,182,669 F544L probably benign Het
Other mutations in Igsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Igsf9 APN 1 172496636 missense probably benign
IGL01665:Igsf9 APN 1 172492171 nonsense probably null
IGL01808:Igsf9 APN 1 172484803 missense probably benign 0.03
IGL02480:Igsf9 APN 1 172496913 missense possibly damaging 0.88
IGL02480:Igsf9 APN 1 172484778 intron probably benign
IGL03087:Igsf9 APN 1 172490743 missense probably benign 0.00
G1citation:Igsf9 UTSW 1 172497163 missense possibly damaging 0.95
R1258:Igsf9 UTSW 1 172492155 missense probably benign 0.02
R1419:Igsf9 UTSW 1 172498011 missense probably damaging 1.00
R2246:Igsf9 UTSW 1 172491649 missense probably benign 0.21
R2427:Igsf9 UTSW 1 172490739 missense probably damaging 0.98
R3900:Igsf9 UTSW 1 172489558 missense probably damaging 1.00
R4334:Igsf9 UTSW 1 172494212 nonsense probably null
R4831:Igsf9 UTSW 1 172491888 missense probably damaging 1.00
R4844:Igsf9 UTSW 1 172497170 missense probably benign 0.00
R4894:Igsf9 UTSW 1 172498067 missense probably benign 0.00
R5016:Igsf9 UTSW 1 172490712 missense probably damaging 1.00
R5358:Igsf9 UTSW 1 172484511 missense probably benign 0.01
R5705:Igsf9 UTSW 1 172494771 missense possibly damaging 0.80
R5762:Igsf9 UTSW 1 172498438 missense probably damaging 1.00
R6058:Igsf9 UTSW 1 172484889 missense probably damaging 1.00
R6510:Igsf9 UTSW 1 172490297 missense possibly damaging 0.78
R6821:Igsf9 UTSW 1 172484493 missense probably benign 0.39
R6822:Igsf9 UTSW 1 172497163 missense possibly damaging 0.95
R6829:Igsf9 UTSW 1 172495674 missense probably benign
R6848:Igsf9 UTSW 1 172495762 missense probably damaging 1.00
R6874:Igsf9 UTSW 1 172494529 missense probably benign
R7224:Igsf9 UTSW 1 172494782 missense probably damaging 1.00
R7284:Igsf9 UTSW 1 172496912 missense probably damaging 0.99
R7292:Igsf9 UTSW 1 172491757 critical splice donor site probably null
R7409:Igsf9 UTSW 1 172495274 missense probably benign
R7744:Igsf9 UTSW 1 172492185 missense probably benign 0.37
R7893:Igsf9 UTSW 1 172497302 missense probably damaging 1.00
V7732:Igsf9 UTSW 1 172490393 missense probably benign 0.19
Z1176:Igsf9 UTSW 1 172492149 missense probably damaging 0.99
Z1176:Igsf9 UTSW 1 172495226 missense probably benign 0.27
Z1177:Igsf9 UTSW 1 172494872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGGCTTTTATCACACATCCC -3'
(R):5'- AAGCGGCTGCAATATGGTATG -3'

Sequencing Primer
(F):5'- CAATTCGGGTCCTTAAGGTCCTG -3'
(R):5'- GAGGAACCTAGTCCTTAGACAAG -3'
Posted On2019-12-03