Incidental Mutation 'R7826:Epha8'
ID602175
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene NameEph receptor A8
SynonymsEphA8, Hek3, Eek
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7826 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location136929419-136956816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136936187 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 483 (M483I)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
Predicted Effect probably benign
Transcript: ENSMUST00000030420
AA Change: M483I

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: M483I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap27 T C 11: 103,338,327 T521A probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Btbd9 A T 17: 30,334,327 I387N probably benign Het
Ccdc27 C T 4: 154,039,501 probably null Het
Ccdc88a A T 11: 29,503,563 H1642L probably benign Het
Cd300c2 C T 11: 115,000,818 V77I possibly damaging Het
Chrnb2 A T 3: 89,763,243 S63T probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah5 C T 15: 28,367,812 T2781M probably damaging Het
Donson T C 16: 91,688,456 D86G possibly damaging Het
Echs1 T A 7: 140,116,436 probably benign Het
Eprs T G 1: 185,406,968 V850G probably damaging Het
Fbxw5 C A 2: 25,502,549 C114* probably null Het
Gm5160 C T 18: 14,425,072 R69C probably benign Het
Gm996 C A 2: 25,578,465 R478L possibly damaging Het
Gpr75 A G 11: 30,891,209 H38R probably damaging Het
Igsf9 T C 1: 172,491,630 V230A probably benign Het
Lonp2 C T 8: 86,709,013 P626S probably damaging Het
Lrrtm1 G T 6: 77,244,112 probably null Het
Man1a2 T C 3: 100,582,139 E508G probably damaging Het
Mipep C A 14: 60,802,131 A203E probably damaging Het
Mrc1 T A 2: 14,294,857 C753S probably damaging Het
Mthfr A G 4: 148,055,010 E568G probably benign Het
Naca T A 10: 128,043,610 probably benign Het
Nek10 G A 14: 14,860,846 probably null Het
Nf2 T C 11: 4,789,750 T419A probably benign Het
Npas3 A G 12: 53,831,756 T164A possibly damaging Het
Nudcd3 T A 11: 6,150,581 I124F possibly damaging Het
Olfr952 A G 9: 39,426,127 *315Q probably null Het
Pappa2 A T 1: 158,936,440 C500* probably null Het
Pcdhb18 T A 18: 37,490,942 S442T probably damaging Het
Phactr4 T C 4: 132,378,441 N105D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Pzp T C 6: 128,487,533 T1344A probably benign Het
Ranbp9 T C 13: 43,419,621 I312V possibly damaging Het
Rsf1 A G 7: 97,661,161 probably benign Het
Slc6a4 A T 11: 77,013,025 I150L probably benign Het
Smpd5 T C 15: 76,296,296 S433P probably benign Het
Spats1 C T 17: 45,452,718 D209N probably damaging Het
Spcs2 C T 7: 99,839,777 G235R probably damaging Het
Sptlc3 T C 2: 139,547,195 M165T probably benign Het
Synm T C 7: 67,735,589 D775G probably damaging Het
Tango6 A G 8: 106,692,613 D264G probably benign Het
Tbc1d30 A T 10: 121,296,805 L218H probably damaging Het
Tmem132d A G 5: 127,789,889 I649T probably damaging Het
Tmem145 T C 7: 25,307,514 Y114H probably damaging Het
Triml1 A T 8: 43,138,766 V185E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,884,876 probably benign Het
Utrn C T 10: 12,401,306 probably null Het
Uty T C Y: 1,137,716 K887E possibly damaging Het
Zfand2b T C 1: 75,168,858 F3L possibly damaging Het
Zfp280d C A 9: 72,312,671 Q243K possibly damaging Het
Zfp418 T C 7: 7,182,669 F544L probably benign Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R2372:Epha8 UTSW 4 136933010 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5552:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R5830:Epha8 UTSW 4 136936390 nonsense probably null
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R6799:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R7918:Epha8 UTSW 4 136934566 missense probably benign 0.12
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8294:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8295:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8445:Epha8 UTSW 4 136932289 missense probably benign 0.13
R8889:Epha8 UTSW 4 136934539 missense probably benign 0.45
R8892:Epha8 UTSW 4 136934539 missense probably benign 0.45
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGGTATGGTTTCTCCCTG -3'
(R):5'- TGTCTTGGTGTAGAAACAGGAG -3'

Sequencing Primer
(F):5'- TCTCACCAGTGGGGCTTCTAG -3'
(R):5'- AGACCAGCGTGTCACTCCTG -3'
Posted On2019-12-03