Incidental Mutation 'R7826:Tmem145'
ID602186
Institutional Source Beutler Lab
Gene Symbol Tmem145
Ensembl Gene ENSMUSG00000043843
Gene Nametransmembrane protein 145
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7826 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25306106-25316195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25307514 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 114 (Y114H)
Ref Sequence ENSEMBL: ENSMUSP00000104046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080288] [ENSMUST00000108409] [ENSMUST00000119703]
Predicted Effect probably benign
Transcript: ENSMUST00000080288
SMART Domains Protein: ENSMUSP00000104047
Gene: ENSMUSG00000058741

DomainStartEndE-ValueType
Pfam:Pro-rich_19 1 366 3.3e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108409
AA Change: Y114H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104046
Gene: ENSMUSG00000043843
AA Change: Y114H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 157 411 7.5e-81 PFAM
low complexity region 486 503 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119703
AA Change: Y114H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112676
Gene: ENSMUSG00000043843
AA Change: Y114H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:GpcrRhopsn4 143 397 4.3e-81 PFAM
low complexity region 478 493 N/A INTRINSIC
Meta Mutation Damage Score 0.1178 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap27 T C 11: 103,338,327 T521A probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Btbd9 A T 17: 30,334,327 I387N probably benign Het
Ccdc27 C T 4: 154,039,501 probably null Het
Ccdc88a A T 11: 29,503,563 H1642L probably benign Het
Cd300c2 C T 11: 115,000,818 V77I possibly damaging Het
Chrnb2 A T 3: 89,763,243 S63T probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah5 C T 15: 28,367,812 T2781M probably damaging Het
Donson T C 16: 91,688,456 D86G possibly damaging Het
Echs1 T A 7: 140,116,436 probably benign Het
Epha8 C T 4: 136,936,187 M483I probably benign Het
Eprs T G 1: 185,406,968 V850G probably damaging Het
Fbxw5 C A 2: 25,502,549 C114* probably null Het
Gm5160 C T 18: 14,425,072 R69C probably benign Het
Gm996 C A 2: 25,578,465 R478L possibly damaging Het
Gpr75 A G 11: 30,891,209 H38R probably damaging Het
Igsf9 T C 1: 172,491,630 V230A probably benign Het
Lonp2 C T 8: 86,709,013 P626S probably damaging Het
Lrrtm1 G T 6: 77,244,112 probably null Het
Man1a2 T C 3: 100,582,139 E508G probably damaging Het
Mipep C A 14: 60,802,131 A203E probably damaging Het
Mrc1 T A 2: 14,294,857 C753S probably damaging Het
Mthfr A G 4: 148,055,010 E568G probably benign Het
Naca T A 10: 128,043,610 probably benign Het
Nek10 G A 14: 14,860,846 probably null Het
Nf2 T C 11: 4,789,750 T419A probably benign Het
Npas3 A G 12: 53,831,756 T164A possibly damaging Het
Nudcd3 T A 11: 6,150,581 I124F possibly damaging Het
Olfr952 A G 9: 39,426,127 *315Q probably null Het
Pappa2 A T 1: 158,936,440 C500* probably null Het
Pcdhb18 T A 18: 37,490,942 S442T probably damaging Het
Phactr4 T C 4: 132,378,441 N105D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Pzp T C 6: 128,487,533 T1344A probably benign Het
Ranbp9 T C 13: 43,419,621 I312V possibly damaging Het
Rsf1 A G 7: 97,661,161 probably benign Het
Slc6a4 A T 11: 77,013,025 I150L probably benign Het
Smpd5 T C 15: 76,296,296 S433P probably benign Het
Spats1 C T 17: 45,452,718 D209N probably damaging Het
Spcs2 C T 7: 99,839,777 G235R probably damaging Het
Sptlc3 T C 2: 139,547,195 M165T probably benign Het
Synm T C 7: 67,735,589 D775G probably damaging Het
Tango6 A G 8: 106,692,613 D264G probably benign Het
Tbc1d30 A T 10: 121,296,805 L218H probably damaging Het
Tmem132d A G 5: 127,789,889 I649T probably damaging Het
Triml1 A T 8: 43,138,766 V185E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,884,876 probably benign Het
Utrn C T 10: 12,401,306 probably null Het
Uty T C Y: 1,137,716 K887E possibly damaging Het
Zfand2b T C 1: 75,168,858 F3L possibly damaging Het
Zfp280d C A 9: 72,312,671 Q243K possibly damaging Het
Zfp418 T C 7: 7,182,669 F544L probably benign Het
Other mutations in Tmem145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Tmem145 APN 7 25314730 missense possibly damaging 0.88
IGL00958:Tmem145 APN 7 25307357 critical splice donor site probably null
IGL01347:Tmem145 APN 7 25314835 missense probably damaging 0.97
IGL01936:Tmem145 APN 7 25311391 missense probably damaging 0.97
IGL02526:Tmem145 APN 7 25308232 missense probably benign 0.20
IGL02686:Tmem145 APN 7 25314725 missense probably damaging 1.00
IGL03182:Tmem145 APN 7 25314879 missense probably damaging 1.00
R0087:Tmem145 UTSW 7 25307843 missense probably damaging 1.00
R0180:Tmem145 UTSW 7 25314699 missense probably benign 0.05
R0329:Tmem145 UTSW 7 25308674 splice site probably benign
R0504:Tmem145 UTSW 7 25311362 missense probably damaging 1.00
R1488:Tmem145 UTSW 7 25307435 splice site probably null
R1681:Tmem145 UTSW 7 25314734 missense possibly damaging 0.95
R2352:Tmem145 UTSW 7 25306173 missense probably benign
R3834:Tmem145 UTSW 7 25311361 missense probably damaging 1.00
R4175:Tmem145 UTSW 7 25308793 missense probably benign 0.04
R4414:Tmem145 UTSW 7 25307129 missense probably damaging 1.00
R4485:Tmem145 UTSW 7 25307162 missense possibly damaging 0.76
R4631:Tmem145 UTSW 7 25307825 missense probably benign 0.00
R4983:Tmem145 UTSW 7 25308602 missense probably benign 0.03
R4999:Tmem145 UTSW 7 25309034 missense probably benign 0.04
R5772:Tmem145 UTSW 7 25315614 missense probably benign 0.21
R5821:Tmem145 UTSW 7 25315521 missense probably benign 0.30
R5909:Tmem145 UTSW 7 25308193 missense possibly damaging 0.89
R6021:Tmem145 UTSW 7 25308845 splice site probably null
R6430:Tmem145 UTSW 7 25309038 missense possibly damaging 0.84
R6768:Tmem145 UTSW 7 25308636 missense probably damaging 1.00
R6778:Tmem145 UTSW 7 25311376 missense probably benign 0.04
R7428:Tmem145 UTSW 7 25307165 critical splice donor site probably null
R7536:Tmem145 UTSW 7 25307869 missense probably damaging 1.00
R7748:Tmem145 UTSW 7 25307328 nonsense probably null
R8253:Tmem145 UTSW 7 25307514 missense probably damaging 1.00
R8441:Tmem145 UTSW 7 25308775 missense possibly damaging 0.62
Z1177:Tmem145 UTSW 7 25309646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTGTCAGAACATCCTCC -3'
(R):5'- TTCACGCACAGAACGGAAGC -3'

Sequencing Primer
(F):5'- TTTGACGACCCATCCCAGTGG -3'
(R):5'- CAGAACGGAAGCTGCGGC -3'
Posted On2019-12-03