Incidental Mutation 'R7826:Triml1'
ID602192
Institutional Source Beutler Lab
Gene Symbol Triml1
Ensembl Gene ENSMUSG00000031651
Gene Nametripartite motif family-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7826 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43129807-43141486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43138766 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 185 (V185E)
Ref Sequence ENSEMBL: ENSMUSP00000050267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059692
AA Change: V185E

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050267
Gene: ENSMUSG00000031651
AA Change: V185E

DomainStartEndE-ValueType
RING 22 62 1.14e-8 SMART
coiled coil region 196 235 N/A INTRINSIC
PRY 291 343 4.64e-23 SMART
Pfam:SPRY 346 462 6.6e-14 PFAM
Meta Mutation Damage Score 0.2754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tripartite motif family protein with similarities to E3 ubiquitin-protein ligases. While the function of the encoded protein has not been determined, the orthologous protein in mouse has been shown to bind ubiquitin-specific protease 5 and is involved in the blastocyst development stage. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap27 T C 11: 103,338,327 T521A probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Btbd9 A T 17: 30,334,327 I387N probably benign Het
Ccdc27 C T 4: 154,039,501 probably null Het
Ccdc88a A T 11: 29,503,563 H1642L probably benign Het
Cd300c2 C T 11: 115,000,818 V77I possibly damaging Het
Chrnb2 A T 3: 89,763,243 S63T probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah5 C T 15: 28,367,812 T2781M probably damaging Het
Donson T C 16: 91,688,456 D86G possibly damaging Het
Echs1 T A 7: 140,116,436 probably benign Het
Epha8 C T 4: 136,936,187 M483I probably benign Het
Eprs T G 1: 185,406,968 V850G probably damaging Het
Fbxw5 C A 2: 25,502,549 C114* probably null Het
Gm5160 C T 18: 14,425,072 R69C probably benign Het
Gm996 C A 2: 25,578,465 R478L possibly damaging Het
Gpr75 A G 11: 30,891,209 H38R probably damaging Het
Igsf9 T C 1: 172,491,630 V230A probably benign Het
Lonp2 C T 8: 86,709,013 P626S probably damaging Het
Lrrtm1 G T 6: 77,244,112 probably null Het
Man1a2 T C 3: 100,582,139 E508G probably damaging Het
Mipep C A 14: 60,802,131 A203E probably damaging Het
Mrc1 T A 2: 14,294,857 C753S probably damaging Het
Mthfr A G 4: 148,055,010 E568G probably benign Het
Naca T A 10: 128,043,610 probably benign Het
Nek10 G A 14: 14,860,846 probably null Het
Nf2 T C 11: 4,789,750 T419A probably benign Het
Npas3 A G 12: 53,831,756 T164A possibly damaging Het
Nudcd3 T A 11: 6,150,581 I124F possibly damaging Het
Olfr952 A G 9: 39,426,127 *315Q probably null Het
Pappa2 A T 1: 158,936,440 C500* probably null Het
Pcdhb18 T A 18: 37,490,942 S442T probably damaging Het
Phactr4 T C 4: 132,378,441 N105D possibly damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Pzp T C 6: 128,487,533 T1344A probably benign Het
Ranbp9 T C 13: 43,419,621 I312V possibly damaging Het
Rsf1 A G 7: 97,661,161 probably benign Het
Slc6a4 A T 11: 77,013,025 I150L probably benign Het
Smpd5 T C 15: 76,296,296 S433P probably benign Het
Spats1 C T 17: 45,452,718 D209N probably damaging Het
Spcs2 C T 7: 99,839,777 G235R probably damaging Het
Sptlc3 T C 2: 139,547,195 M165T probably benign Het
Synm T C 7: 67,735,589 D775G probably damaging Het
Tango6 A G 8: 106,692,613 D264G probably benign Het
Tbc1d30 A T 10: 121,296,805 L218H probably damaging Het
Tmem132d A G 5: 127,789,889 I649T probably damaging Het
Tmem145 T C 7: 25,307,514 Y114H probably damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Ttn T G 2: 76,884,876 probably benign Het
Utrn C T 10: 12,401,306 probably null Het
Uty T C Y: 1,137,716 K887E possibly damaging Het
Zfand2b T C 1: 75,168,858 F3L possibly damaging Het
Zfp280d C A 9: 72,312,671 Q243K possibly damaging Het
Zfp418 T C 7: 7,182,669 F544L probably benign Het
Other mutations in Triml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Triml1 APN 8 43140961 splice site probably benign
IGL00920:Triml1 APN 8 43138682 missense probably damaging 1.00
IGL01319:Triml1 APN 8 43141397 utr 5 prime probably benign
IGL01323:Triml1 APN 8 43138563 splice site probably null
IGL01998:Triml1 APN 8 43141313 missense probably damaging 1.00
IGL02394:Triml1 APN 8 43138592 missense possibly damaging 0.57
R0359:Triml1 UTSW 8 43130505 missense probably damaging 1.00
R0400:Triml1 UTSW 8 43141040 missense probably benign 0.03
R1799:Triml1 UTSW 8 43130475 missense probably damaging 1.00
R2008:Triml1 UTSW 8 43130605 missense probably damaging 0.97
R2363:Triml1 UTSW 8 43141371 missense probably damaging 0.99
R2405:Triml1 UTSW 8 43130283 missense probably damaging 1.00
R5333:Triml1 UTSW 8 43130290 missense possibly damaging 0.82
R6093:Triml1 UTSW 8 43140718 missense probably benign 0.04
R6244:Triml1 UTSW 8 43138756 nonsense probably null
R6808:Triml1 UTSW 8 43141221 missense probably damaging 0.99
R6860:Triml1 UTSW 8 43130566 missense probably damaging 1.00
R7231:Triml1 UTSW 8 43136371 missense probably benign
R8054:Triml1 UTSW 8 43130383 missense probably damaging 0.99
R8100:Triml1 UTSW 8 43138680 missense probably benign
R8234:Triml1 UTSW 8 43141248 missense probably benign 0.25
Z1088:Triml1 UTSW 8 43130398 missense probably damaging 1.00
Z1177:Triml1 UTSW 8 43140705 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GACAGGTAGACTCAATCCGC -3'
(R):5'- TCGTTCAGTAGGAATGACAGTTC -3'

Sequencing Primer
(F):5'- GCCCAATCATTTTGCCGAGG -3'
(R):5'- ACTGTTGGGTACATATGCACC -3'
Posted On2019-12-03